0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf

báo cáo hóa học:

báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf

... mental health. The World Health Organisation states that health is a state of completephysical, mental and social well-being and not merely the absence of disease or infirmity and mental health ... validation of a culturally relevant scale in a multi-ethnic asian populationJanhavi Ajit Vaingankar1*†, Mythily Subramaniam1†, Siow Ann Chong1, Edimansyah Abdin1, Maria Orlando Edelen2,Louisa ... statistical parameters and impacton the final instru ments’ content, ta king into account the phrasing of the items and their meaning.1. Exploratory factor analysis (EFA): The s ample wasrandomly...
  • 18
  • 487
  • 0
báo cáo hóa học:

báo cáo hóa học: " The relationship between anxiety, coping strategies and characteristics of patients with diabetes" docx

... constitutesconstantly changing cognitive, behavioural and emo-tional efforts to manage particular external and/ or inter-nal demands that are appraised as taxing or exceeding the resources of the individual ... items included in any scale were included in the study.Results The total mean and standard deviation of trait anxiety in two types of diabetes was 46.98 ± 6.14. The mean of traitanxiety score of ... participated in the study design and wrote the manuscript. TT, IM and DEG carried out the data analysis. MK participated in the study design and crit-ically reviewed the manuscript, and all authors...
  • 9
  • 592
  • 0
báo cáo hóa học:

báo cáo hóa học: " The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy" doc

... between change in visual acuity defined as a con-tinuous variable and change in the VFQ-25 scales,controlling for age, gender, and visual acuity at baseline. In all models, except the one with the ... ocular painsubscale as the dependent variable, change in visual acuitywas significantly associated with change in the VFQ-25 scale (p < 0.0001). Baseline visual acuity was also associ-ated ... conducted among patients with a range of oculardiseases including macular degeneration, glaucoma, and cataract [13,17,20,21].Although the association between visual acuity and HRQLat one point in...
  • 10
  • 523
  • 0
báo cáo hóa học:

báo cáo hóa học:" The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy pot

... citation purposes)had a somewhat larger percentage of Caucasian patients. The change analysis sample was primarily male (64.1%) and Caucasian (81.9%), with a mean age of 59.3 years.This sample ... the change group is a five-level inde-pendent variable. Age and baseline visual acuity arecontinuous covariates, and gender is a categorical covari-ate. The dependent variables were change ... provide a rough indication of the precise areas of HRQL and functioning that may tend to change along with vis-ual acuity in patients with diabetic retinopathy.SAS statistical software version...
  • 10
  • 474
  • 0
báo cáo hóa học:

báo cáo hóa học: " The Psychosocial Screen for Cancer (PSSCAN): Further validation and normative data" pptx

... establishedcriterion measure, namely the HADS subscales, a criterion of 8 or above on the HADS Anxiety Scale was taken as anindication of a subclinical diagnosis and a criterion of 11or above ... differ in health status.Sample 1 was the large sample (n = 570) of cancer patientsdescribed in the original manuscript [10]. Sample 2 was a small in- patient sample of cancer patients, and Samples ... have con-ducted additional analyses to recommend specific cut-offscores and have also gathered data from healthy, norma-tive adult samples so that both the clinical and healthynorm data can...
  • 8
  • 513
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The molecular dynamic simulation on impact and friction characters of nanofluids with many nanoparticles system" pot

... had a small deformation, and with largerone in case 2, the nanoparticle was squashed and largedeformation had been made. In the meantime of press-ing nanoparticle, distribution of atoms in ... m/s; the velocity of nano-particles in lower layer is much lower than that of nanoparticles in upper layer, and the main reason mightbe the absorption force of plate for the nanoparticles. And ... of Energy and Power Engineering, Dalian University of Technology,Dalian 116024, China.Full list of author information is available at the end of the articleLv et al. Nanoscale Research Letters...
  • 8
  • 295
  • 0
Báo cáo Y học: The sodium pump Its molecular properties and mechanics of ion transport potx

Báo cáo Y học: The sodium pump Its molecular properties and mechanics of ion transport potx

... or cardiac glycosides, such as ouabain and digitalis. Other substances, like palytoxin from marinecorals of the genus Palythoa or sanguinarine from the plantSanguinaria canadensis, are also ... understanding the translocation process,or at least in gaining some room for speculation. The Kdp-ATPase of bacteria is a particularly interestingK+-transporting ATPase made up of three proteincomponents: ... occlusionpocket. In the last part of the reaction sequence, the release of K+into the intracellular medium, the enzyme can beviewed as a ligand-activated ion channel where ATP is the ligand whose binding...
  • 10
  • 488
  • 0
báo cáo hóa học:

báo cáo hóa học:" Gene expression profiling for molecular distinction and characterization of laser captured primary lung cancers" ppt

... covering 8793 genes, and stained according to the manufacturer's instructions.Quantification, normalization and statistical analysis The quality control, normalization and data analysis, ... cellcontact and tumor spreading. The extracellular cell matrix receptors integrin alpha-3 and integrin beta-2 as well as the collagen binding protein-1(SERPHINH1) were upregulated in AC. These ... his-topathological review of the tumor samples. AS wasinvolved in the tumor sample collection. AVH and MRwere involved in the statistical analysis of the data. JN, GG and MS were involved in the...
  • 17
  • 662
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Novel Data Fusion Method and Exploration of Multiple Information Sources for " ppt

... CCAAATAAGG,GCCCATGTAAGGAG, GAAACGCCATATAAGGAGCAGG,GCAGCGCCTTATATGGAGTGGC, CTCCAAATTTAGGC,TGCTTCCCATATATGGCCATGT, CCATATTAGG, CTATTATGGTBP 1 (C)TATAAA (A) , TACAAAT, TTAAA,ATAAATA, TTAAAT, TATAAGTCF1 1 GTTATTGGTTAAAGAAGTATA,GTGTAGGTTACTTATTCTCCTTTTGTTGATEAD1 ... GTTATTGGTTAAAGAAGTATA,GTGTAGGTTACTTATTCTCCTTTTGTTGATEAD1 2 (AA)CATTCCTT(CGG), AGGAGGAATGTGCTRP53 2 GAGCAAGTCA, ATACAAGGCCEURASIP Journal on Advances in Signal Processing 7Table 1: AUC scores and ... GAGCGTGGCGGGCCGCG,(AGGG)TGGGCAG(TCC), GAGGTGGGGGG, AGCCAG,(GGGGGGGGGGGGGGGG)GGGCGG(GGCCGTGGCT),(CCTAAAGTGCTTCCAAA)CTTGGCAAGGGCGAGAGAGGGCGGGTGGSRF 1 ACCCAAATATGGCT, CCTTACATGG,CCAAGAATGG, CCAAATAAGG,GCCCATGTAAGGAG,...
  • 15
  • 332
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article Minimal Nielsen Root Classes and Roots of Liftings" pptx

... homotopy invariant, and it is independent of the selectedpoint a ∈ Y , provid that Y is a manifold. In this case, there is no danger of ambiguity in denotit by Nf. In a similar way as in the previous ... lifting through some covering space and not having all Nielsenroot classes with minimal cardinality. In this section, we study the relationship between the minimal number of roots of a map and the ... Fixed Point Theory and Applications In 3,Gonc¸alves and Aniz exhibit an example which we adapt for dimension two and summarize now. Take the bouquet of m copies of the sphere S2,andletf :...
  • 16
  • 220
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo giáo dục thể chất trường tiểu họctrang bìa báo cáo đại học hoa senBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ