báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
... Dr. Irina Kerkis for anti-bodies supplying; Marcos Valadares and Maria Denise Fernandes Carvalho for the support with the cultures. Mrs. Constancia Urbani for secretarial assistance. FAPESP/CEPID, ... discarded in surgical proceduresTatiana Jazedje1, Paulo M Perin2, Carlos E Czeresnia3, Mariangela Maluf2, Silvio Halpern2, Mariane Secco1, Daniela F Bueno1, Natassia M Vieira1, ... implythat htMSCs represent a cell population that can be rap-idly expanded for potential clinical applications. The morphological and functional integrity of the tubalepithelium are of paramount...
- 10
- 456
- 0
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... prior data indicating an interaction between this viral protein and hsp90 [26,30]raises the possibility that geldanamycin may have antivi-ral activity against influenza A as well as a variety ... introduced, the ratiosof cRNA to mRNA and vRNA to mRNA changed byaround 8 fold across the temperature range. When a cRNA-like CAT RNA was transfected the cRNA:mRNAratio decreased by over 3-fold and the ... bandshift assaybased on recombinant polymerase expressed from vac-cinia virus and short synthetic v- and cRNA panhandleRNAs [24]. When nuclear extracts containing the influ-enza virus polymerase...
- 16
- 313
- 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
... Russia, eastern Asia, Austra-lia, and New Zealand, and has the potential totransmit pathogens including viruses, rickettsia andprotozoan parasites that cause important human andanimal diseases ... longicornisNeumann (resurrected) of Australia, New Zealand, NewCaledonia, Fiji, Japan, Korea, and Northeastern Chinaand USSR, and its parthenogenetic and bisexual popula-tions (Ixodoidea, Ixodidae). J Parasitol ... maintained at the Laboratory of ParasiticDiseases, National Institute of Animal Health (Tsukuba,Ibaraki, Japan), were bred by feeding on rabbits asdescribed previously [18].Animal ethicsAll animals...
- 14
- 432
- 0
báo cáo hóa học:" Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors" docx
... treatment of malignant brain tumorsHemant SarinAddress: National Institute of Biomedical Imaging and Bioengineering, National Institutes of Health, Bethesda, Maryland, USAEmail: Hemant Sarin ... malignant brain tumormicrovasculature is approximately 12 nanometers. Spherical nanoparticles ranging between 7 nmand 10 nm in diameter maintain peak blood concentrations for several hours and are ... thoughmalignant gliomas are generally treated with a combina-tion of surgery, radiotherapy and systemic chemother-apy[7,8], and metastatic brain tumors with a combinationof surgery and radiotherapy...
- 14
- 492
- 0
báo cáo hóa học: " Occupational risk of overweight and obesity: an analysis of the Australian Health Survey" pptx
... smokedat least 100 cigarettes and information about ages theyhad started and ceased smoking.Data handling and statistical analysis The weighting factors for each record were computed by the ABS ... significantly lower mean BMIis found in managers and administrators, professionaland associate professional, advanced clerical and serviceworkers and intermediate and elementary sales and ser-vice ... design, analysis,interpretation of results and manuscript writing.AB participated in the study design, interpretation of results and manuscriptpreparation.All authors read and approved the final...
- 9
- 373
- 0
báo cáo hóa học:" What do standard radiography and clinical examination tell about the shoulder with cuff tear arthropathy?" docx
... para-meters as well as the total Constant score and all radi-ological parameters cited above are analysed.Statistical analysis was performed with R (a languageand environment for statistical computing) ... Coordinating; providing data; providing study idea; writing the article.All authors have read and approved the final manuscript.Competing interests The authors declare that they have no competing ... these patients had a standard radiograph in neutral rotation as used in daily practice, 187 of themhad a CT-scan and 31 had an MRI-scan.All data was filled in on uniform charts by the responsi-ble...
- 7
- 521
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... GAGGCTAGATACTGCTCGATGTIL-10 forward3 TGATGATTTGGAACCATTATTGAAIL-10 reverse3 CACCTTTTTCCTTCATCTTTTCATb-Actin forward1 ACTACCTCATGAAGATCCTGb-Actin reverse1 TTGCTGATCCACATCTGCTGT7- forward TAATACGACTCACTATAGGGSP6-reverse ... 4653Cloning, characterization and expression analysis of interleukin-10 from the common carp,Cyprinus carpioL.Ram Savan1, Daisuke Igawa2and Masahiro Sakai21United Graduate School of Agricultural ... analysis.Cytokines play a significant role in initiating and regulating the in ammatory process, which is an important defensesystem in innate immunity. Cytokines are subdivided intofamilies such as interleukins...
- 8
- 584
- 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... 24660–24664.9 Lu CT, Tada T, Nakamura Y, Wada K, Nishimura K,Katsuya Y, Sawada M, Takao M & Sakai T (2000)Crystallization and preliminary X-ray analysis of endo-polygalacturonase SE1 from Trichosporon ... mole-cule mainly consists of (partly methylated) homogalac-turonan, interspersed with rhamnogalacturonan units,which often contain sugar side chains composed ofarabinan and galactan [1].Degradation ... kinetic models of octaga-lacturonate, using three polygalacturonases (including A. aculeatus polygalacturonase), and concluded that the binding clefts in polygalacturonases can accommodatemaximally...
- 10
- 592
- 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc
... Adenocarcinomas and Barrett’s EsophagusEsophageal adenocarcinoma is an entity of increasingclinical importance, due to an unexplained incidencerise among white males in the Wester n world [1], and a dismal ... one of the six ‘hall-marks of cancer’ , initially described by Hanahan andWeinberg [28,29]. Invasive and metastatic capabilitiesare largely mediated by extracellular proteases, whichare able ... Aragon A, Moran-Jimenez MJ, Gomez-Camara A, De Salamanca RE, Moreno-Gonzalez E:Relationship between biomarker expression and allelic alteration in esophageal carcinoma. J Gastroenterol Hepatol...
- 11
- 647
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... Maruyama T, Nakanishi K,Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic associationbetween the interleukin-2 receptor-alpha gene and mode of onset oftype 1 diabetes in the Japanese ... quite large interval also encompasses o therimmune-relevant genes such as IL15RA, and the authorscould not pin-point the causal variant with the locus[28]. The genetic interval was significantly ... Diseases. C .A. P holds a CanadaResearch Chair. E.d’H. and M.K. are recipients of a fellowship from the CIHRtraining grant in Neuroinflammation. M.K. is a recipient of a fellowship from the Research...
- 12
- 573
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròright from the start taking charge in a new leadership role pdfNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ