0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf

báo cáo hóa học:

báo cáo hóa học:" Is there a relationship between factor V Leiden and type 2 diabetes?" doc

... http://www.translational-medicine.com/content/7/1/ 52 Page 3 of 4(page number not for citation purposes)Statistical analysisData are expressed as mean ± standard deviation (SD) oras number and percentage where appropriated. Statisticalanalysis ... linking between FVL gene variant,diabetes and atherothrombosis and other vascular complications, although data on largerpopulation are needed; this aspect may be another relevant topic of research ... FVL gene variant, diabetes and athero-Table 2: Prevalence of diabetes or IGT in subjects with VTE and with or without FVL.Patients with VTE and FVL (n. 64) Patients with VTE and without FVL...
  • 4
  • 594
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Gait training with partial body weight support during overground walking for individuals with chronic stroke: a pilot study" ppt

... under each eva-luation were averaged for each participant. A one-wayanalysis of variance (ANOVA) was conducted, usingevaluation (before and after gait training) as a factor andmean walking ... training with partial body weight support during overground walking for individuals with chronic stroke: a pilot studyCatarina O Sousa1, José A Barela2,3, Christiane L Prado-Medeiros1, Tania ... 8:48http://www.jneuroengrehab.com/content/8/1/48Page 7 of 7JNERJOURNAL OF NEUROENGINEERING AND REHABILITATION Gait training with partial body weight support during overground walking for individuals with chronic stroke:...
  • 8
  • 284
  • 1
báo cáo hóa học:

báo cáo hóa học: " Is dental amalgam safe for humans? The opinion of the scientific committee of the European Commission Joachim Mutter" pdf

... 6:2http://www.occup-med.com/content/6/1/2Page 2 of 17REVIEW Open Access Is dental amalgam safe for humans? The opinion of the scientific committee of the European Commission Joachim MutterAbstractIt was claimed by the Scientific Committee ... 11:331-337.doi:10.1186/1745-6673-6-2Cite this article as: Mutter: Is dental amalgam safe for humans? The opinion of the scientific committee of the European Commission. Journal of Occupational Medicine and ... time of joining the mili-tary [218]. Another problem occurring in some studies is the absence of documentation of the dental statusbefore or at the time of the onset of multiple sclerosis.In...
  • 17
  • 454
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... S. litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850, respectively) and 85% with S. exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823;AY127899 and AJ277555, ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT 63 |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG...
  • 11
  • 854
  • 0
báo cáo hóa học:

báo cáo hóa học:" Is there added risk in resurfacing a femoral head with cysts?" ppt

... femoral head with cysts?Thomas P Gross and Fei Liu*AbstractBackground: Femoral head cysts have been identified as a risk factor for early femoral failures after metal-on-metalhip resurfacing arthroplasty ... recommend that the presence ofcysts within the femoral head, as long as they compriseless tha n 1/3 of the remaining prepared femoral head, beeliminated as a risk factor for HRA . We suggest thatother ... problematic group (N = 13). A univariate analysis ofmultiple risk factors was done. Points were assigned tocertain risk factors based on their odds ratio in this ana-lysis. Two points were assigned...
  • 7
  • 505
  • 0
báo cáo hóa học:

báo cáo hóa học:" Benefits of an educational program for journalists on media coverage of HIV/AIDS in developing countries" docx

... number not for citation purposes)Journal of the International AIDS SocietyOpen AccessResearch Benefits of an educational program for journalists on media coverage of HIV/AIDS in developing countriesJorge ... respectively, per month in the time since the conference. Radio and newspaper cov-erage are the most likely means for dissemination of infor-mation in the developing world, since only minimalinfrastructure ... curriculum content anddidactic quality of information delivered to journalists (process evaluation) and,b) explore the effects of such programs on reporting of HIV/AIDS related information (outcome...
  • 10
  • 447
  • 0
báo cáo hóa học:

báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf

... CongoEquatorial GuineaEritreaGabonGambiaGhanaGuineaGuinea-BissauLesothoLiberiaMadagascarMalawiMaliMauritaniaMauritiusNigerSao Tome and PrincipeSenegalSeychellesSierra LeoneSwazilandTogoZimbabweFraction ... such as infant mortality and all cause mortal-ity" [24].The purpose of this study is to assess the association between PEPFAR funding and changes in a broad rangeof health indicators among ... bestpublicly available information we are aware of, we notethat many data points were unchanged between 2000 and 2006. The lack of any apparent change over this six-yearTable 1: Overall changes in health...
  • 9
  • 342
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt

... 23:5http://www.enveurope.com/content/23/1/5Page 7 of 9COMM E N TAR Y Open Access REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)Ivana Teodorović*, ... description of the FP 6 fundedREP LECOTOX project and the profile of LECOTOX research team.Authors’ contributionsIT drafted the manuscript and participated in the design and coordination of the FP 6 ... potential of “omic” methods in ecotoxicological research and risk assessment, LECO-TOX team made an initial step towards application of genomics-based tools in ecotoxicology, aiming to com-bine transcriptomics...
  • 9
  • 374
  • 0
báo cáo hóa học:

báo cáo hóa học:" Review Article An Overview of the Lower and Upper Solutions Method with Nonlinear Boundary Value Conditions" doc

... Elsevier/North-Holland, Amsterdam, The Netherlands,2004.14 C. De Coster and P. Habets, An overview of the method of lower and upper solutions for ODEs,”in Nonlinear Analysis and Its Applications to ... books of Bernfeld and Lakshmikantham 6 and Ladde et al. 7 the classical theory of the method of lower and upper solutions and the monotone iterativetechnique are given. This gives the solution ... Corporation Boundary Value ProblemsVolume 2011, Article ID 893753, 18 pagesdoi:10.1155/2011/893753 Review Article An Overview of the Lower and Upper Solutions Method with Nonlinear Boundary Value...
  • 18
  • 393
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article An Adaptive Channel Interpolator Based on Kalman Filter for LTE Uplink in High Doppler Spread Environments" docx

... jointly by Kalman filter in time domain during training symbols. Since channel tapinformation is missing between the training symbols of twoconsecutive slots within a single subframe, an interpolationoperation ... Kalman Filter for LTE Uplink in High Doppler S pre ad EnvironmentsBahattin Karakaya,1H¨usey in Arslan,2and Hakan A. C¸ırpan11Department of Electrical and Electronics Engineering, Istanbul ... domain for LTE uplink systems. Uponacquiring the estimates of channel taps from the Kalman tracker, we employ an interpolation algorithm based on polynomialfitting whose order is changed adaptively....
  • 10
  • 376
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article An Efficient Addressing Scheme and Its Routing Algorithm for a Large-Scale Wireless Sensor Network" pptx

... propose an elegant addressing scheme and its routing algorithm. While maintaining the existing address scheme, it tackles the wastage problem and achieves no additional memory storage during a routing. ... 16 bits and is partitioned equally, everydimension will have the range of 0 and 255. Similarly, twoaddress dimensions may be arbitrarily allocated—say, 10 bits for x-axis and 6 bits for y-axis. ... Proceedings of IEEE Wireless Communications and Networking Conference (WCNC ’02), vol.1, pp. 350–355, Orlando, Fla, USA, March 2002.[9] W. R. Heinzelman, A. Chandrakasan, and H. Balakrish-nan, “Energy-efficient...
  • 13
  • 366
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx

... Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density FunctionSamir Saoudi,1, 2Molka Troudi,3and Faouzi Ghorbel41Institut ... using only 3000 samples, gives a value of theBER with an error of 0.2dB.7. ConclusionsIn this paper, we have suggested a new iterative soft bit error rate estimation for the study of any digital ... give a brief description of the MCsimulation for any digital communication system. Let usconsider any point to point system communication over any channel transmission (Gaussian, multipath fading,...
  • 9
  • 340
  • 0
báo cáo khoa học:

báo cáo khoa học: "Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive localized Gastric Adenocarcinoma?" pptx

... (hematoxylin eosin stain, 100 ×). Figure 1 1Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive localized Gastric Adenocarcinoma? Yassir ... be made available soon.Is there any advantage to combined trastuzumab and chemotherapy in perioperative setting Her 2neu positive localized Gastric Adenocarcinoma?World Journal of Surgical Oncology ... locally gastric cancer over expressing HER2 . The use of oxaliplatin and capecitabine in combination with trastuzumab in this setting remains experimental, and ideally should be considered only in...
  • 18
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Is there an association between anti-TNF monoclonal antibody therapy in rheumatoid arthritis and risk of malignancy and serious infection" ppt

... there was an CommentaryIs there an association between anti-TNF monoclonal antibody therapy in rheumatoid arthritis and risk of malignancy and serious infection? Commentary on the meta-analysis ... Sweeting MJ, Buchan I, Matteson EL,Montori V: Anti-TNF antibody therapy in rheumatoid arthritis and the risk of serious infections and malignancies: system-atic review and meta-analysis of rare ... and coworkers [1]conducted a meta-analysis of the incidence of infections and cancer occurring in the different treatment arms of thepublished anti-TNF monoclonal antibody trials.Summary of...
  • 3
  • 360
  • 0
Báo cáo y học:

Báo cáo y học: "Is there an optimal minimally invasive technique for left anterior descending coronary artery bypas" pdf

... Port-Access coronary artery bypassgrafting; MIDCAB, minimally invasive direct coronary artery bypass grafting;TECAB, totally endoscopic coronary artery bypass grafting; CCSC, CanadianCardiovascular ... thesurgical technique performed. PA-CABG, Port-Access coronary artery bypass grafting; MIDCAB, minimally invasive direct coronary artery bypass grafting; TECAB, totally endoscopic coronary artery bypass ... coronary artery bypassgrafting; MIDCAB, minimally invasive direct coronary artery bypass grafting;TECAB, totally endoscopic coronary artery bypass grafting; ICU, intensive careunit; MI, myocardial...
  • 6
  • 483
  • 0

Xem thêm

Từ khóa: is there any difference between stock market and share marketis there any difference between these transplantations and face transplantationencephalitis encephalopathy in an emergency hospital in japan a retrospective study of 105 cases in 2002 2011báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbài tập nâng cao hóa học 10 có đáp ángiáo án lớp 10 nâng cao hóa họctrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxbáo cáo sơ kết công tác an toàn an ninh trường họcthiết kế bào giảng hoá học 12 nâng caoBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ