Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
... Corresponding author AbstractIn recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures ... strains from databases we found that 74 (61.2 %) out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' end of the 9T1-1 primer, previously associated with the failure ... CentralPage 1 of 4(page number not for citation purposes)Virology JournalOpen AccessShort report Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure...
- 4
- 329
- 0
báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx
... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red.TCTTGTCAAAGCAAATAATA3’5’Das primer, 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea primer, aBT1Target sequenceTarget sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATA ... UV-light. Nucleotide mismatches in the primersFigure 2 Nucleotide mismatches in the primers. The target sequence is the VP7 gene of G1 Bangladeshi strains. The G1 rotavirus VP7 gene specific primers ... that the Das primer setcould not detect most of the G1 rotaviruses in the previ-ous years and that a majority of the untypeable rotaviruseswere G1 strains.ConclusionBecause of the natural...
- 5
- 355
- 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red.TCTTGTCAAAGCAAATAATA3’5’Das primer, 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea primer, aBT1Target sequenceTarget sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATABioMed ... sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATABioMed CentralPage 1 of 5(page number not for citation purposes)Virology JournalOpen AccessResearchTyping of human rotaviruses: Nucleotide mismatches ... acid identities with the Indian G1 rotavirus strain, ISO-4). To comparethem with the typeable G1 sequences, the VP7 genes of two typeable G1 strains, Dhaka8-02 [Gen-Bank:AY631049] and Matlab159-02...
- 5
- 389
- 0
Báo cáo hóa học: " Some like it hot: environmental determinism and the pastoral economies of the later prehistoric Eurasian steppe" docx
... example,Petropavlovsk in the north of K azakhstan has an average yearly temperature of 1.5°C and an average precipitation of 366 mm, and desert land on the Syr-Darya in the south of Kazakhstan has an average ... semi-deserts and deserts of Central Asia and the Black and Caspian Seas, with the further vegetation zone of alpine and mountain pastures of the uplands of Central Asia(Kerven et al. 1996; Kremenetski ... Koryakova and Hanks 2006Q Kazakhs of Kokchetav District, early 19thcentury Koryakova and Hanks 2006Note: (Koryakova and Hanks 2006, table one) tabulate cattle, horse and sheep data (rather...
- 16
- 279
- 0
báo cáo hóa học:" Research Article On Some Geometric Constants and the Fixed Point Property for Multivalued Nonexpansive Mappings" pot
... η.3.12Hence, the inequality CZX ≤ CZX follows from the arbitrariness of η.10 Fixed Point Theory and Applications The characteristic of noncompact convexity of X associated with the measure of noncompactness ... Multivalued Nonexpansive MappingsJingxin Zhang1 and Yunan Cui21Department of Mathematics, Harbin Institute of Technology, Harbin 150001, China2Department of Mathematics, Harbin University of ... Benavides and Gavira 7 have established FFP for multivaluednonexpansive mappings in terms of the modulus of squareness, universal infinite-dimension-al modulus, and Opia modulus. Attapol Kaewkhao...
- 12
- 460
- 0
Báo cáo hóa học: " Research Article An ML-Based Estimate and the Cramer-Rao Bound for Data-Aided Channel Estimation in KSP-OFDM" pdf
... guardinterval are added to the first ν samples from the data part of the received signal, and then the N samples from the datapart are applied to an FFT, while the guard interval samples are not transformed. ... the datapart of the received signal are transformed to the frequencydomain by an FFT, and the guard interval samples are nottransformed. In ZP-OFDM, first the samples from the guardinterval ... 1024: the spreading of the pilots over the spectrumbecomes again uniform. Also at low values of M, the aver-age value of the GCRB and the variance of the GCRB are increased. At low M, the contribution...
- 9
- 283
- 0
Báo cáo hóa học: " Research Article Multivariate Twisted p-Adic q-Integral on Zp Associated with Twisted q-Bernoulli Polynomials and Numbers" pdf
... polynomials and numbers are called the twistedBernoulli polynomials and numbers, respectively. When k 1,q 1, and ζ 1, the polynomials and numbers are called the ordinary Bernoulli polynomials ... βkn,ζ,q0 are called the twisted q-Bernoulli numbers of order k. When k 1, the polynomials and numbers are called the twisted q-Bernoulli polynomials and numbers,respectively. When k 1andq 1, the ... we can see the relations between the binomial coefficients and the modifiedextension of the twisted q-Bernoulli polynomials of order k.Acknowledgments The authors would like to thank the anonymous...
- 6
- 181
- 0
báo cáo hóa học:" No relationship between the distribution of mast cells and the survival of stage IIIB colon cancer patients" potx
... cancer stroma. The mast cell count in the nor-mal mucosa adjacent to the colon cancer was associated with the TNM classification characteristics and hepaticmetastases, although it was not a prognostic ... metastasis (MCCslnm )and in the lymph tissue adjacent to the metastasis (MCCalnm).Although MCCalnmwas higher in papillary and tubularadenoma s than in mucoid and signet ring adenomas, and although ... (MCClnwm)were evaluated as MCCstroma. All evaluated section wereobtained from areas far from the area of necrosis and H.E. staining was review ed in uncertain cases. T he mastcell count in each sec...
- 6
- 360
- 0
báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx
... ACTTCAGCGAGACCG-3';ABCC2 reverse: 5'-CCAGCCAGTTCAGGGTTT-3'; ACTBforward: 5'-CACCCAGCACAATGAAGAT-3'; ACTBreverse: 5'-CA AATAAAGCCATGCCAAT-3'. Cycling condi-tions ... the experimental procedures and in the interpretation of the data, SXW, XL, TFL and WBX gave advises on the work and helped in the interpretation of the data, KTY supervised all the work and wrote the paper ... complicated handling of the samples. High performance liquid chromatography(HPLC) is a rapid, economic and validated way to deter-mine the accumulation of cisplatin in plasma, cancer celland...
- 9
- 509
- 0
báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx
... ICAM-1 and VCAM-1 predict pre-clinical cancer. Eur J Cancer 2005, 41:2355-9.19. Maruo Y, Gochi A, Kaihara A, Shimamura H, Yamada T, Tanaka N,Orita K: ICAM-1 expression and the soluble ICAM-1 ... Jaureguibeitia1, Aritz Lopategi2, Iñigo Martínez1, Lorea Mendoza1, Francisco J Muruzabal1, Clarisa Salado1 and Fernando Vidal-Vanaclocha*2,3Address: 1Pharmakine Ltd., Bizkaia ... Mendoza - lmendoza@pharmakine.com; Francisco J Muruzabal - fmuruzabal@pharmakine.com; Clarisa Salado - csalado@innoprot.com; Fernando Vidal-Vanaclocha* - fernando.vidal@ehu.es* Corresponding author...
- 12
- 419
- 0
Từ khóa: under a 15 degree lao view an 8 9 cm 17 gauge epidural needle is gently advanced into the left subxyphoid region with intermittent injection of a small amount of contrast material entry into the epicardial space is verbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP