Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... Tajima K. An epidemiological study of HBV, HCV, and HTLV-1 in Sherpas of Nepal. Asian Pac J Cancer Prev. 2004; 5(4):370-3. 30. Panigrahi AK, Panda SK, Dixit RK, Rao KV, Acharya SK, Dasarathy ... world. Incidence rates across the world fluctuate and are difficult to calculate given the asymptomatic, often latent nature of the disease prior to clinical presentation. Prevalence rates across ... F, Costantino A, Rapicetta M, Lecce R, Taliani G. High prevalence of hepatitis C virus infection in a small central Italian town: lack of evidence of parenteral exposure. Ital J Gastroenterol...
- 6
- 486
- 0
Báo cáo Y học: Toxicity of novel C-terminal prion protein fragments and peptides harbouring disease-related C-terminal mutations pdf
... truncated version of PrP c can beconverted into a truncated PrPSccapable of infecting thesame transgenic mice and inducing neurodegeneration. The106 amino acids comprise the amino-acid residues ... converted to a protease resistant form(PrPSc)that cannot be cleaved at the normal cleavage site.PrPScrepresents an altered isoform that differs markedly inconformation and accumulates to high ... metalloproteasedisintegrins ADAM10 and ADAM17 [18]. However, thecellular fate or function of these fragments after cleavageremains unknown. Conformational change in PrP c structureresults in a higher percentage of b...
- 10
- 495
- 0
Báo cáo hóa học: " Quality of Life as reported by school children and their parents: a cross-sectional survey" docx
... multidimensional, and include physical,psychological and social well-being factors. QoL measureshould also take account of the developmental stage of the child, be applicable to all children in a given culture, and ... between parents and children (aged 7 to 11years) compared to parents and adolescents has also beenreported for a study of cancer patients [20].Child and parent reports obtained in clinical and ... ="Often" and 5 = "Always"). Mean scores are calculated foreach of the six subscales and for the total scale and linearlytransformed to a 0 – 100 scale.For the German KINDL,...
- 11
- 567
- 0
Báo cáo hóa học: " Evaluation of upper extremity robot-assistances in subacute and chronic stroke subjects" doc
... results of observed catching efficiency (CE) and mean forces (MF) duringthe catching phase of the task. The subacute and chronic subjects are divided into the groups with catching assistance (CA) and ... assistance and grasping assistance on the catching efficiency, placing efficiency and on movement-dependant parameters: meanreaching forces, deviation error, mechanical work and correlation ... goal of the task is to catch a ball that rolls down a sloped table and place it in a basketabove the table. Our study examines the influence of catching assistance, pick -and- place movement assistance...
- 9
- 704
- 0
Báo cáo hóa học: " Control of the upper body accelerations in young and elderly women during level walking" pot
... trialunder analysis. Higher values of the coefficients indicate a more effective head stabilisation strategy and a higherreduction of the inertial loads.Statistical analysisThe average values ... analy-sis. AC conceived the study and participated in its design and coordination and helped to draft the manuscript. Allauthors read and approved the final manuscript.AcknowledgementsThis study was ... Rome, ItalyEmail: Claudia Mazzà* - claudia.mazza@iusm.it; Marco Iosa - marco.iosa@iusm.it; Fabrizio Pecoraro - fabrizio.pecoraro@iusm.it; Aurelio Cappozzo - aurelio.cappozzo@iusm.it* Corresponding...
- 10
- 431
- 0
báo cáo hóa học: " Behaviour of motor unit action potential rate, estimated from surface EMG, as a measure of muscle activation level" potx
... citation purposes)BackgroundBy means of surface electrodes placed at the skin above a muscle the electrical activity accompanying muscle con-tractions can be measured non-invasively (surface ... direction.Morphological, electrical and physiological parametervalues were based on data of the biceps brachii (defaultvalues of the software package). For a full list of parametersettings, see Table 1.Simulation ... calculation of θ. Shaded area indicates the part of the electrode detection area that lies within the subcutaneous layer and does not contain MUs.Journal of NeuroEngineering and Rehabilitation...
- 13
- 441
- 0
báo cáo hóa học: " Reliability of voluntary step execution behavior under single and dual task conditions" doc
... intraclass correlation coeffi-cient (ICC) [26]. We used ICC(2,1) which assumes eachsubject is assessed by each rater and the raters are ran-domly selected and reliability calculated from a singlemeasurement. ... effects of age and task condition on the mean depend-ent variables were calculated with SPSS (version 10.1, Chi-cago, IL) using a two-way repeated-measures analysis of variance (ANOVA) that included ... reaction force data included onset latency of step initiation (initiationphase), preparation and swing phases, foot-off and foot-contact times.Results: Intraclass correlation coefficients (ICC(2,1))...
- 7
- 409
- 0
báo cáo hóa học: " Effects of visually simulated roll motion on vection and postural stabilization" pptx
... that was computedfor each COP and head position as arithmetic averages of standard deviations across periods of the identical condi-tion or of the same category of perception.The postural ... and A/ P directions, and areshown in Tables 1, 2, 3 and 4 along with the standarddeviations. The detailed time-series data are shown graph-ically in Figures 4c and 4d, and 5c and 5d. The values ... vis-ual-stimulus-motion in a trial, and (4) the observer's rat-ings of vection strength.In the analyses described above, we examined averages of the COP and head position data across all the trials and allthe...
- 11
- 824
- 0
báo cáo hóa học: " Inhibition of secreted phospholipase A2 by neuron survival and anti-inflammatory peptide CHEC-9" docx
... A2 s (sPLA2s) are of interest in this regardbecause of their accessibility in the circulation and because local and systemic elevation of sPLA2s are associ-ated with most forms of inflammation ... Sapirstein A, Hung CC, Alessandrini A, Bonventre JV:Cross-talk between cytosolic phospholipase A2 alpha(cPLA2 alpha) and secretory phospholipase A2 (sPLA2) inhydrogen peroxide-induced arachidonic acid ... buffer consisting of 50 mM tris (pH =7.4), 0.1 M NaCl, 2 mM CaCl2, 0.25% fatty acid-free albu-min (Sigma) and the CHEC-9 peptide at the indicatedconcentrations. CHEC-9 (CHEASAAQC) was synthesizedby...
- 9
- 293
- 0
báo cáo hóa học: " Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice" pot
... bp commercially available Genexpression Assay QuantiTect Mm_ Tnfsf6 241122 C1 -Inh 12258 NM_009776134 bp AACTTAGAACTCATCAACACCTGTTATCTTCCACTTGGCACTCACACCTGCCTCGTCCT custom made* NCBI, National ... alternative pathway complementactivity (zymosan assay) and a significant inhibition of complement anaphylatoxin C5 a levels (ELISA data) at 4 and 24 hours after trauma, compared to placebo controls.However, ... inhibitors((CrryCrry--IgIg, sCR1, , sCR1, rVCPrVCP))AntiAnti-- C5 C5 AbsAbs C5 a C5 a antagonistsantagonistsAntiAnti-- C5 aR (CD88) C5 aR (CD88) AbsAbs C1 C1 --InhInhJournal of...
- 12
- 465
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcbáo cáo y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ