Báo cáo hóa học: " A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes" doc
Báo cáo hóa học: " A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes" doc
... purposes)Virology JournalOpen AccessResearch A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopesAlagarsamy Srinivasan*1, Velpandi Ayyavoo*2, ... Pennsylvania School of Medicine, Dept of Pathology and Laboratory Medicine, 243 John Morgan, Philadelphia PA 19104, USAEmail: Alagarsamy Srinivasan* - alagarsamy.srinivasan@gmail.com; Velpandi Ayyavoo* ... eleven. The N-termi-nal domain contains a total of 79 variant amino acids. Of these, non-conserved substitutions correspond to about80% of the residues. The impact of the majority of the polymorphisms...
- 17
- 434
- 0
báo cáo hóa học:" A comprehensive review of 46 exercise treatment studies in fibromyalgia (1988–2005)" ppt
... majority" of subjects completed a certain number of classes or thatthere was a natural break in the data at a certain number of classes. This is problematic in that the "dose" of the intervention ... duration and intensity of the exercise, attrition, and outcome variables from the meth-ods section of the full text articles or from the abstract, ifonly the abstract was available. Any disagreements ... found.Modes of training and control interventionsMost interventions were comprised of the three majormodes of exercise (aerobic training, strength training, flex-ibility) either singly or in combination....
- 6
- 455
- 0
báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx
... time.Furthermore, these data can be stored in a database. Uti-lizing this system, the values of the progress in the exer-cises can easily be stored and re-accessed for furtherexamination and evaluation.Competing ... target.All participants were tested between 10 AM and 4 PM. Alltests were performed with the right hand.Data analysis Kinematic data sampling and information processingHand position data ... rehabilitation personal and patients.Characterizing the features of reaching and quantifyingspecific variables allows therapists to treat specific deficits[19]. The normative data collected in this...
- 8
- 551
- 0
Báo cáo hóa học: " A comparative analysis of viral matrix proteins using disorder predictors" docx
... that although the high levels of mutation caused difficulties in the development of vac-cines against new strains of the influenza, there are effec-tive vaccines against specific strains of the ... regions could be crucial for the inter-subunit interactions. In fact, analysis of the crys-tal structure of the p15 protein revealed that residues 46and 78 of the chain A are involved in interaction ... years after infection [8]. For thisreason, the use of SIV on Asian monkeys has become the standard animal model [47]. However, the extrapolation of data from animal models to HIV in human remains...
- 10
- 449
- 0
báo cáo hóa học:" A retrospective analysis of clinicopathological and prognostic characteristics of ovarian tumors in the State of Espírito Santo, Brazil" ppt
... Cerri1, Ana Cristina N Chiaradia1, Alex A Carvalho4,Ian V Silva3and Leticia BA Rangel1*AbstractBackground: Ovarian cancer is sixth most common cancer among women and the leading cause of ... based on the combina-tion of a platinum-derived compound (carboplatin, mainly,or cisplatin), and a taxane (paclitaxel). As documented byAebi and Castiglione [35], the referred drug combinationseems ... tumor and non-epithelial EOC from the analysis. Statistical Analysis Data are expressed as absolute values and percentage oras mean ± standard deviation (SD). Statistically relevantPaes et al....
- 10
- 459
- 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf
... insight into the causes of the distinct behavior of daunorubicin and WP631,we compared the intracellular accumulation of these com-pounds in Jurkat T cells overtime. We also examined the rate ... phase contrast and fluorescence photo-graphs of selected field of cells obtained under the samemagnification and contrast acquisition characteristics, andusing the autofluorescence of the anthracycline ... high AnnexinV-Fluosstaining and low propidium-iodide staining are clearly more abundantafter treatment with daunorubicin (D).Fig. 4. Quantitative determination of the uptake of daunorubicin andWP631...
- 7
- 581
- 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx
... mutations on RNA-binding andcleavage assays were evaluated. A RNA binding assay of the different mutants wasperformed using native MS, as indicated above. In allcases, the relative binding percentages ... (kid A5 5G)PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G)PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G)PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change ... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E)PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E)PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid...
- 14
- 477
- 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... immuno-chemical staining to examine the cell population of AT-MSC-Hepa for microarray analysis. This analysis showed that the AT-MSC-Hepa cell population wasalmost totally homogeneous ([16], and data not ... 1267 the up- and down-regulated gene data using an Euclideandistance calculation based on the Ward method calculationby genmaths software (Applied Maths, Austin, TX, USA).Gene ontology analysis Gene ... time interval of transcription initiation[25], and regulate transactivation of several endoderm-and hepatocyte-specific factors, including transthyretin,albumin and tyrosine aminotransferase...
- 14
- 597
- 0
Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot
... speaker differences.Table 1: Classification accuracy of different learn-ing methods for the task of classifying the transcript of a conversation side according to the gender -male/female - of ... side?Each conversation always consists of two peopletalking to each other. Up to this point, we have onlyattempted to analyze a conversation side in isola-tion, i.e. without using transcriptions ... first characterizing the gender of the current speaker and the second the gender of the other speaker, i.e. FF, FM, MF, MM. The task re-mains the same: given the transcript of a conver-sation side,...
- 8
- 347
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... Medical College of Wisconsin, Milwaukee, WI, USA and 4Section on Statistical Genetics, Department of Biostatistics, University of Alabama at Birmingham, Birmingham, AL, USAEmail: Julie A Panepinto* ... functioning. The total score is comprised of the average of all items in the questionnaire. The psychosocialsummary score is comprised of the average of the items in the emotional, social, and ... alpha for each of the 8 subscales of the PedsQL™ Family Impact Module as wellas for the summary and total scores. A Cronbach's alphacoefficient of greater than 0.70 was considered acceptablefor...
- 11
- 552
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015