0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

Báo cáo hóa học:

Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

... Científicas, Caracas) and a sec-ondary antibody conjugated to alkaline phosphatase. Fociwere stained using a combination of 5-bromo-4-chloro-3'-indolylphosphate p-toluidine salt and nitro-blue ... Recently, a commercial enzyme immunoassay, Platelia™ Dengue NS1 AG (Bio-Rad Laboratories), wasdeveloped for the detection of NS1 antigen in humanserum or plasma. This assay has been reported to be usefulfor ... Kalayanarooj S,Nisalak A, Norman JE, Ennis FA, Rothman AR: Analysis of plasmaviral RNA levels during acute dengue virus infection usingquantitative competitor reverse transcription-polymerasechain...
  • 8
  • 383
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

... balance maintenance and arm transport. All participants practicedten 90-s gaming trials during a single session, followed by a retention test. Arm-postural coordination was analysedusing principal ... train-ing arm-postural coordination, utilized the basic principles of game design, and included tasks calibrated according to the patient’s anatomical features and movement abilities.This paper ... with a traumatic brain injury. Brain Inj 2002,16:231-244.5. Kuhtz-Buschbeck JP, Stolze H, Gölge M, Ritz A: Analyses of gait, reaching,and grasping in children after traumatic brain injury. Arch...
  • 11
  • 793
  • 0
báo cáo hóa học:

báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

... insoluble material and immu-noprecipitated by incubation with a saturating amount(as determined by prior titration) of a cocktail containing1.5 µgs of anti-F mAbs and protein -A agarose beads (Inv-itrogen, ... Fprotein and a transcriptional transactivator fusion proteinconsisting of the GAL4 DNA-binding domain fused to theactivation domain of NFκB. These effector cells weremixed with a separate set of ... mMnon-essential amino acids, 1.0 mM sodium pyruvate and10% heat-inactivated, gamma-irradiated fetal bovineserum (FBS) (HyClone Laboratories, Salt Lake City,Utah). AK-D cells (CCL-150) were maintained in...
  • 12
  • 541
  • 0
báo cáo hóa học:

báo cáo hóa học: " Development of a self-reporting tool to obtain a " docx

... (Clínica CLINISAS, Madrid), I Vallejo (HospitalClinic, Barcelona), J Vidal (Hospital General, Guadalajara). Milena Gobbo andUnidad de Investigación de la Fundación Española de Reumatolog a, fortheir ... technical support.Author details1Facultad de Psicolog a, Universidad Nacional de Educación a Distancia,Madrid, Spain.2Unidad de Reumatolog a, Instituto Provincial deVallejo et al. Health and ... (ICAF)An exploratory factor analysis was made involving thescales resulting from i tem reduction indicated in thesection above. With a KMO of 0.86, four factorsexplaining 64% of the variance...
  • 7
  • 460
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 ... CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...
  • 16
  • 646
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Unified Approach to List-Based Multiuser Detection in Overloaded Receivers" pot

... 2:SystemmodelforaULAandaUCAwithM = 4-elementsand D>Msingle-antenna users.2.2. Uniform linear array In the ULA configuration, isotropic antenna elements arelocated in a straight line with equal spacing ... 1996.[9] S. Talwar and A. Paulraj, “Blind separation of synchronousco-channel digital signals using an antenna array—part II:performance analysis,” IEEE Transactions on Signal Processing,vol. ... incident onthe antenna array with greater spread in AOA interfere witheach other less than signals that are closely spaced in AOA.CCI from users reasonably widely spaced in AOA can thusbe effectively...
  • 14
  • 209
  • 0
Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

Báo cáo Y học: Effects of ATP depletion and phosphate analogues on P-glycoprotein conformation in live cells docx

... at 37 °C in an incubator containing 5%CO2and maintained by regular passage in Dulbecco’sminimal essential medium (supplemented with 10% heat-inactivated fetal bovine serum, 2 mML-glutamine ... that cyclosporin A (CsA), vinblastine, and valinomycin (and several otherdrugs; N. Nagy, K. Goda, F. Fenyvesi & G. Szabo´Jr,unpublished data)1interactwithPgpinsuchamannerthatpreincubation ... concentrations of thechemicals applied increased steady-state daunorubicinaccumulation to the approximate level reached in Pgp–parental cells and did not significantly increase the ratio of dead...
  • 6
  • 590
  • 0
Báo cáo khoa học: Effect of ecdysone receptor gene switch ligands on endogenous gene expression in 293 cells docx

Báo cáo khoa học: Effect of ecdysone receptor gene switch ligands on endogenous gene expression in 293 cells docx

... exocyticand endocytic pathways because Rab proteins plays a key role in membrane trafficking [25]. Barbosa et al.[26] reported that mutations in the Rab gene(s) cancause irregularities in the protein ... D. melanogaster DabIP. The DabIP partici-pates in a signaling complex containing various pro-teins involved in brain development as well as otheraspects of adult brain function [55]. Although ... Keshvara L, Rice DS &Curran T (2003) Interaction of Disabled-1 and theGTPase activating protein Dab2IP in mouse brain. MolBrain Res 115, 121–129.56 Piddini E, Schmid JA, Martin R &...
  • 21
  • 414
  • 0
báo cáo hóa học:

báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

... Figure 2a, saturation of binding was achieved at a concentration of 60–70 nM of AF488-MCP-1. Since the internalization assay is to beused as a measure of pharmacodynamic effect of a CCR2antagonist, ... cytometry-based pharmacodynamic assays. Herewe report the validation of a flow cytometry-based chemokine internalization assay for use in evaluating the effect of a receptor antagonist in clinical trials. ... individualsand all days (Table 5). In- study resultsThis assay was used as a pharmacodynamic marker forbiological activity of a CCR2 antagonist in a clinical trialconsisting of 108 healthy individuals....
  • 12
  • 829
  • 0
báo cáo hóa học:

báo cáo hóa học: "Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia" pptx

... of pain relieving/anti-inflammatory drugs to treat arthritis and bodily pain,which predominated as reasons for NSAID use (in the CFSgroup). The significantly more common use of narcoticpain ... were taking such drugs to reduce the stomach side effects of an NSAID (etodolac).Among users of pain-relieving/anti-inflammatory drugsonly, concurrent use of anti-acid drugs was significantlymore ... frequency of use of NSAIDs (aspirin excluded) among controls in our studyappears comparable to the 32% estimated prevalence of joint pain in the general population of Georgia, or 33%for the USA [17],...
  • 11
  • 512
  • 0

Xem thêm

Từ khóa: bao cao hoa bai phan tich dinh tinh cac nguyên tố trong một hợp chat huu cobáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quotlựa chọn xây dựng và sử dụng hệ thống bài tập hoá học phần hóa đại cương lớp 10 ban nâng caotuyên tập cac bao cao khoa học hội nghị khoa học địa i apos aBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ