0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học:

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... S. litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850, respectively) and 85% with S. exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823;AY127899 and AJ277555, ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT 63 |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG...
  • 11
  • 854
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article An Efficient Addressing Scheme and Its Routing Algorithm for a Large-Scale Wireless Sensor Network" pptx

... commandLAA updaterequest command A BCDEFH IJFigure 4: An example of the address assignment based on LAA. a node A initiates the creation of a new ZigBee network byassigning itself as a ... (d)Interval,Cskip(d)021152130ZigBee standard, ZigBee Pro by now, claimed that the neweststandard could handle thousands of sensors. However, webelieve that our proposal, although originally designated for general WSNs, can be ... consists of 16 bits and is partitioned equally, everydimension will have the range of 0 and 255. Similarly, twoaddress dimensions may be arbitrarily allocated—say, 10 bits for x-axis and 6 bits for...
  • 13
  • 366
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article An Alternative Method to Compute the Bit Error Probability of Modulation Schemes Subject to Nakagami-m Fading" pdf

... Nakagami-m fading channel is seen as an additive noise channel whose noise is modeled as theratio between a Gaussian random variable and a Nakagami-m random variable. Exact and closed-form expressions ... for an AWGN channel, a closed-form expression for the BEP of M-QAM for an AWGN channel has been derivedonly in 2002 [4].Regarding the performance evaluation of QAM for a Rayleigh fading channel, ... the Nakagami-m fading channel is seen as an additive noise channel whosenoise is modeled as the ratio between Gaussian and Nakagami-m random variables. The method consists of using the cumulativedensity...
  • 12
  • 404
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Holoprosencephaly in an Egyptian baby with ectrodactyly-ectodermal dysplasia-cleft syndrome: a case report" doc

... expression and can occur as a separate entity, the combination of allthree anomalies appears to be a rare occurrence [6].HPE is a complex brain malformation affecting boththe forebrain and the face. ... holoprosencephaly.Authors’ contributionsKA and HS diagnosed, investigated, followed-up and managed the patient and drafted the manuscript. Both authors read and approved the finalmanuscript.Competing ... , she had bilateral ectrodactyly of both hands and feet, dry rough skin, sparse hair of thescalp and operated right cleft lip and cleft palate. Computerized tomography of her brain revealedholoprosencephaly.Conclusion:...
  • 5
  • 254
  • 0
báo cáo hóa học:

báo cáo hóa học:" Struma ovarii associated with pseudo-Meigs’ syndrome and elevated serum CA 125: a case report and review of the literature" pdf

... approximately 20% of all ovarian tumors. Of these, approximately 15% con-tain normal thyroid tissue. Struma ovarii is a monoder-mal variant of ovarian teratoma, which predominantlycontains thyroid ... 52(1):94-96.doi:10.1186/1757-2215-3-18Cite this article as: Jiang et al.: Struma ovarii associated with pseudo-Meigs’ syndrome and elevated serum CA 125: a case report and review of the literature. Journal of Ovarian Research 2010 ... thegross appearance of a fibroma (fibroma, thecoma, granu-losa cell tumor), accompanied by ascites and hydro-thorax. While similar clinic manifestations presented inother conditions was term ed as...
  • 4
  • 540
  • 0
báo cáo hóa học:

báo cáo hóa học:" Is there an association between PEPFAR funding and improvement in national health indicators in Africa? A retrospective study" pdf

... 2006-1.5-1.0-0.50.00.51.01.5FocusBotswanaCote d'IvoireEthiopiaKenyaMozambiqueNamibiaNigeriaRwandaSouth AfricaUgandaUnited Republic of TanzaniaZambiaDuber et al. Journal of the International AIDS Society ... (IQRs).† PEPFAR focus countries are Botswana, Cote d'Ivoire, Ethiopia, Kenya, Mozambique, Namibia, Nigeria, Rwanda, South Africa, Uganda, United Republic of Tanzania, Zambia. All PEPFAR focus ... Republic of the Congo, Equatorial Guinea, Eritrea, Gabon, Gambia, Ghana, Guinea, Guinea-Bissau, Lesotho, Liberia, Madagascar, Malawi, Mali, Mauritania, Niger, Sao Tome and Principe, Senegal, Seychelles,...
  • 9
  • 342
  • 0
báo cáo hóa học:

báo cáo hóa học:" Association between treated/untreated traumatic dental injuries and impact on quality of life of Brazilian schoolchildren" pot

... DG, IP and MV conceptualized the rationale and designed thestudy. CB, SP, CT, AO, DG and MV performed the data collection, statisticalanalysis and interpretation of the data. CB, SP, CT and DG ... research team was made up of three dentists (CBB,DG and CST), who had participated in a training and calibration exercise for each clinical condition. TheAndreasen classification [13] was used ... Paiva1*, Cíntia S Torres1, Ana C Oliveira2, Daniela Goursand1, Isabela A Pordeus1,Miriam P Vale1AbstractBackground: Traumatic dental injury (TDI) could have physical and psychosocial consequences...
  • 8
  • 290
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article An Energy-Efficient MAC Protocol in Wireless Sensor Networks: A Game Theoretic Approach" pptx

... wait-ing time in backoff procedure. In “Incomplete Game”, accessdelay performance is far better than “NM”, and comparablewith “IBM”, as it can easily adapt the variable game state and choose the ... proceding of International Symposium onFusion Tech (ISFT), January 13–15, 2009.[14] S. Mehta and K. S. Kwak, “Performance analysis of binaryexponential backoff andimprovedbackoff for WAPN,”EURASIP ... probability (pc )of a competing node. Also, the probability pcis constant and independent at each transmission attempt. A node transmits a data packet with the probability ptrin a randomly...
  • 10
  • 313
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Remarks on Cone Metric Spaces and Fixed Point Theorems of Contractive Mappings" pptx

... obtain similar results as Theorem 4 for example in 1.References1 L G. Huang and X. Zhang, “Cone metric spaces and fixed point theorems of contractive mappings,”Journal of Mathematical Analysis ... Combinatorics and Ordered Sets (Arcata, Calif., 1985), vol. 57 of Contemporary Mathematics, pp.175–226, American Mathematical Society, Providence, RI, USA, 1986.11 M. A. Khamsi and W. A. Kirk, An Introduction ... Ili´candV.Rakoˇcevi´c, “Common fixed points for maps on cone metric space,” Journal of Mathematical Analysis and Applications, vol. 341, no. 2, pp. 876–882, 2008.5 S. Rezapour and R. Hamlbarani,...
  • 7
  • 215
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article On the Connection between Kronecker and Hadamard Convolution Products of Matrices and Some Applications" pptx

... 763–784, 2007.8 A. Kilic¸man and Z. Al Zhour, “The general common exact solutions of coupled linear matrix and matrix differential equations,” Journal of Analysis and Computation, vol. 1, no. ... pagesdoi:10.1155/2009/736243Research ArticleOn the Connection between Kronecker and Hadamard Convolution Products of Matrices and Some ApplicationsAdem Kılıc¸man1 and Zeyad Al Zhour21Department of Mathematics, ... Institute for Mathematical Research, University Putra Malaysia,43400 UPM Serdang, Selangor, Malaysia2Department of Mathematics, Zarqa Private University, P.O. Box 2000, Zarqa 1311, JordanCorrespondence...
  • 10
  • 325
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbài tập nâng cao hóa học 10 có đáp ángiáo án lớp 10 nâng cao hóa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ