Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx

... design, data analyses, manuscript preparation;SCB data analyses and manuscript review, and MBR per-forming experiments; JC Luminex data analysis and inter-pretation. PK and HSJ data interpretation; ... citation purposes)Virology JournalOpen AccessShort report Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic ... importance and role that differentcytokines and chemokines play in acute RSV disease sever-ity.Instead of targeting individual cytokines as potential ther-apeutic targets, we took advantage...

Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

... took an alternative approach toexplore the relative importance and role that differentcytokines and chemokines play in acute RSV disease sever-ity.Instead of targeting individual cytokines as ... before virus inoculation. Bronchoalveolar lavage (BAL) and serum sampleswere obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplexassay (Beadlyte Upstate, ... directed against a wellconserved epitope of the RSV F protein. In summary, in the mouse model, prophylactic adminis-tration of motavizumab significantly decreased RSV repli-cation, the local and systemic...

báo cáo hóa học: " Influenza A (H1N1) 2009: Impact on Frankfurt in due consideration of health care and public health" pptx

... with a standardized and coordinated international information sharing is crucialfor the management not only for pandemic influenza butall pandemics [22]. The setting of standards for copingFigure ... for swine flu(36.3%), and seasonal influenza (40.5%), than the averageannual uptake of the influenza vaccine in the Germanhealth care system (approximately 22%). Nevertheless,vaccination ... UniversityHospital Frankfurt were vaccinated against seasonalinfluenza, and 36.3% (n = 1,416/3,900) were vaccinatedagainst influenza A/ H1N1/2009 ("swine flu"). The average age of an employee of the...

báo cáo hóa học: " Towards a brief definition of burnout syndrome by subtypes: Development of the “Burnout Clinical Subtypes Questionnaire” (BCSQ-12)" doc

... socio-demo-graphic and occupational characteri stics was conducted,using means and standard deviations for age and per-centages for the other variables. Contrasts were madedepending on the sub-sample ... Petros Skapinakis3,4, Ricardo Araya3, Margarita Gili5 and Javier Garc a- Campayo1*AbstractBackground: Burnout has traditionally been described by means of the dimensions of exhaustion, ... enthusiasm in work-relatedtasks; ‘boredom’ is caused by the understanding of work as a mechanical and routine experience with little variation in activities; and ‘lack of development’ is the absence...

báo cáo hóa học:" How a well-grounded minimal important difference can enhance transparency of labelling claims and improve interpretation of a patient reported outcome measure" pdf

... painful or painless, strokes can be mild or severe, and myocardial infarctions can be large and complicated orsmall and uncomplicated. The way the investigatorspresent the results of clinical ... [46]. The third approachevaluates the score change in relation to measurementprecision. Examples include standard error of the mean[47] and a reliable change index [48]. As a measure of var-iability, ... that expanding this section and making it more specific will benefit all stakeholders:patients, clinicians, other clinical decision makers, thosedesigning trials and making claims, payers and...

báo cáo hóa học:" Serum high mobility group box-1 (HMGB1) is closely associated with the clinical and pathologic features of gastric cancer" pptx

... postulatesthat a progression from chronic gastritis to gastric atrophy,intestinal metaplasia (IM), dysplasia, and finally to cancer('gastritis-dysplasia-carcinoma' sequence) [14]. In ... method. Clinical parameters,International Union Against Cancer (UICC) TNM stage, cancer size, differentiation or lymphaticinvasion, vascular or perineural invasion and prognosis were used as analysis ... 196:163-170.16. Oue N, Aung PP, Mitani Y, Kuniyasu H, Nakayama H, Yasui W:Genes involved in invasion and metastasis of gastric canceridentified by array-based hybridization and serial analysis ofgene...

báo cáo hóa học:" Tremorgenesis: a new conceptual scheme using reciprocally innervated circuit of neurons" pptx

... especially the pallidum and the subthalamic nucleus, but are mainlysynchronized by cortical activity via the striatal inputs.There is an abnormal coupling between the EMG of fore-arm muscles and ... loops has specific anatomical con-nections, inherent time delays, adaptable gains and interacts with a myriad of sensory feedback signals [5]: -the loop between motor cortex and basal ganglia -the ... determines the excitability of the membrane. By increasing specific mem-brane conductances that are known to increase PIR and neural excitability, such as Ih and It, they could simulate the range...

báo cáo hóa học:" HLA-A" doc

... kanomasa@sapmed.ac.jp; Takuro Wada - twada@sapmed.ac.jp; Mitsunori Kaya - mkaya@sapmed.ac.jp; Satoshi Nagoya - nagoya@sapmed.ac.jp; Toshihiko Yamashita - tyamasit@sapmed.ac.jp; Noriyuki Sato - nsatou@sapmed.ac.jp* ... Kawaguchi* - kawaguch@sapmed.ac.jp; Toshihiko Torigoe - torigoe@sapmed.ac.jp; Akari Takahashi - atakahashi@sapporo.jst-plaza.jp; Masaki Murase - murasem@sapmed.ac.jp; Masanobu Kano - kanomasa@sapmed.ac.jp; ... Tsukahara T, Kimura S, Ichimiya S, Torigoe T, Kawaguchi S, Wada T,Yamashita T, Sato N: Scythe/BAT3 regulates apoptotic celldeath induced by papillomavirus binding factor in humanosteosarcoma....

Báo cáo hóa học: " Melanoma: A model for testing new agents in combination therapies" doc

... vinblastine, dacarbazine, interleukin-2, and interferon alfa-2b with cisplatin, vinblastine, and dacarbazine alone in patients with metastatic malignant melanoma (E3695): a trial coordinated ... comparing the response rates of carmustine, dacarbazine, and cisplatin with and without tamoxifen in patients with metastatic melanoma. National Cancer Institute of Canada Clinical Trials Group. ... Medical Oncology and Innovative Therapy, National Tumor Institute, Naples, Italy, 2Cancer Therapy Evaluation Program, National Cancer Institute, Bethesda, MD, USA and 3Melanoma Program, Yale...

Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx

... was amplified by tworounds of PCR using semi-nested primers. The primer setBG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC)were used in the first round and BG2 and ... can elevate fetal hemo-globin have great potential as therapeutic agents. The DNA methyltransferase (DNMT) inhibitors 5-azacytidine and 5-aza-2’deoxycyidine (decitabine) have been shown toincrease ... on the treatment of this disease[7]. Although decitabine and 5-azacytidine have a potentialrole as HbF inducers to treat b-hemoglobinopathies, theseagents have pharmacological limitations including...

Xem thêm