báo cáo hóa học: " Acute lead intoxication in a female battery worker: Diagnosis and management" ppt
báo cáo hóa học: " Acute lead intoxication in a female battery worker: Diagnosis and management" ppt
... differential diagnosis. Moreover, this report indicates that lead remains a significant occupational hazard especially in the small scale battery industryBackground Lead is a significant occupational ... 10.1186/1745-6673-5-19Cite this article as: Dounias et al., Acute lead intoxication in a female battery worker: Diagnosis and management Journal of Occupational Medicine and Toxicology 2010, 5:19 ... R, Agosti A, Scafa F, Candura SM: Anaemia and abdominal pain due to occupational lead poisoning. Haematologica 2007, 92:e13-4.15. Mohammadi S, Mehrparvar A, Aghilinejad M: J Occup Med Toxicol...
- 4
- 347
- 0
báo cáo hóa học:" GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment" pptx
... province), Yin-chuan School for the Blind, Deaf and Dumb (Ningxia Province), Xining Spe-cial Education School (Qinghai province), Changan School for the Deaf and Dumb (Shaanxi province), Affiliated ... also ana-lyzed for mutations in Exon1 and flanking introns byPCR/sequencing. The PCR primers used are forwardprimer:5'CTCATGGGGGCTCAAAGGAACTAGGAGATCGG3' and reverse primer 5'GGGGCTGGACCAACACACGTC-CTT ... PCR amplified with forward primer5'TTGGTGTTTGCTCAGGAAGA 3' and reverse primer5'GGCCTACAGGGGTTTCAAAT 3'. Among this studycohort, 851 patients from central China were also ana-lyzed...
- 12
- 507
- 0
báo cáo hóa học: " Health-state utilities in a prisoner population: a cross-sectional survey" pdf
... original data and revised the manuscript. MDK was involved in data inter-pretation and manuscript revision. HT was involved in study design, data organization, early data interpretation and manuscript ... Murray D Krahn2,9 and Hla-Hla Thein10Address: 1Section of General Internal Medicine, Lakeridge Health Oshawa, Canada, 2Faculty of Health Sciences, Queen's University, Ontario, Canada, ... statisti-cal analysis, interpreted the data and wrote the first draft.SL provided a literature review and helped draft the man-uscript. GCN provided statistical support and early datainterpretation,...
- 7
- 362
- 0
báo cáo hóa học: " Health-state utilities in a prisoner population: a cross-sectional survey" docx
... statistical support and early datainterpretation, and helped draft and revise the paper. ASconceived the original idea for this paper and revised themanuscript. TB and MHL were involved in ... originalsurvey used in this paper, provided the original data and revised the manuscript. MDK was involved in data inter-pretation and manuscript revision. HT was involved in study design, data ... organization, early data interpretation and manuscript revision. All authors read and approvedthe final manuscript.AcknowledgementsThe original survey used for this study [6] was financially...
- 7
- 312
- 0
báo cáo hóa học: " Health predicting factors in a general population over an eight-year period in subjects with and without chronic musculoskeletal pain" potx
... the findings. SA and SB carried out the sta-tistical analyses and drafted the manuscript. All authorsread and approved the final manuscript.Additional materialAcknowledgementsThis study was ... longitudinal study in a gen-eral population with postal surveys at baseline and at aneight-year follow up, and was a part of the Epipain project[22].Subjects and data collectionThe target population ... musculoskeletal pain atbaseline, and regarding smoking habits, never being a smoker or being a former smoker, compared to being a current smoker, was significantly (P < 0.05) associatedwith having a...
- 9
- 368
- 0
báo cáo hóa học: " Negligible heat strain in armored vehicle officers wearing personal body armor" pptx
... mid-shift samples. In thesecases, the average USG was taken as the mid-shift value.Eight AVOs had USG data at all time points, and wereused in statistical analysis.Data are summarized as mean and ... Standardisation: ISO 9886: Ergonomics -Evaluation of thermal strain by physiological measurements. Geneva:International Organisation for Standardisation; 2004.25. International Organisation for Standardisation: ... work tasks and indicated thatalthough core temperature and sweat loses were similarbetween security personnel wearing PBA and those whowere not, heart rate and skin temperature were higher,and...
- 6
- 257
- 0
báo cáo hóa học: " Educators'''' working conditions in a day care centre on ownership of a non-profit organization" pot
... using this program information could be gained about main and secondary activities and quantitative information about direct child contact. All activities (main and secondary) were recorded in ... h). Activities in this category mostly involved singing, dancing and other sportive activities as well as preparation and conducting small experiments. Internal communication and meetings ... Singing, sportive activities, preparation und conducting of small experiments Cleaning Cleansing of rooms and toys, plants and animal husbandry Continuing education /Supervision Attendance at...
- 22
- 257
- 0
báo cáo hóa học:" Bipolar hip hemiarthroplasty in a patient with an above knee amputation: a case report" pptx
... conclude that an ambulatingpatient with an above knee amputation and a subcapitalfracture should be operated on after appropriate planning and preparation with satisfactory results. A patient canreturn ... studies[4,6] have shown that this an appropriatestrategy for most fractures after an amputation, except dis-placed intertrochanteric and cervical fractures that requiresurgical fixation. In our case, ... preoperative level of ambulation and activityafter rehabilitation.Consent'Written informed consent was obtained from the patientfor publication of this case report and accompanyingimages....
- 4
- 427
- 0
báo cáo hóa học:" Positron emission tomography in ovarian cancer: 18F-deoxy-glucose and 16α-18F-fluoro-17β-estradiol PET" docx
... Hatanaka Y, Harada M, Higashida Y, Taka-hashi M, Mizutani H, Tashiro H, Iwamasa J, Miyazaki K: Adnexalmasses: accuracy of characterization with transvaginal US and precontrast and postcontrast ... ovarian carcinoma A systematic review and meta-analysis. Eur J Radiol 2008:29.48. Kitajima K, Murakami K, Yamasaki E, Domeki Y, Kaji Y, Fukasawa I,Inaba N, Suganuma N, Sugimura K: Performance ... ovarian cancer (small arrow) with metastases in the abdomen (arrow head) (A) . FDG-PET demonstrated ovarian cancer (small arrow) and multiple metastases in the abdomen and pelvis (arrow head), and...
- 10
- 225
- 0
báo cáo hóa học:" Viral load testing in a resource-limited setting: quality control is critical" potx
... Kaharuza F,Alexander L, Solberg P, Tappero J, Moore D: Utility of Routine Viral Load,CD4 Cell Count, and Clinical Monitoring among HIV-Infected Adults in Uganda: A Randomized Trial [abstract]. ... antiretroviral therapy for HIV infection in adults and adolescents Geneva: World Health Organization; 2009.8. Petti CA, Polage CR, Quinn TC, Ronald AR, Sande MA: Laboratory medicine in Africa: a barrier ... MSF laboratoryscientist for: training of personnel; appropriate labora-tory facilities; workflow; separation of areas for samplepreparation, reagent preparation and sample analysis;backup power...
- 6
- 300
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam