báo cáo hóa học: " Apolipoprotein E isoform-dependent dendritic recovery of hippocampal neurons following activation of innate immunity" pot
Báo cáo Y học: Apolipoprotein E predisposes to obesity and related metabolic dysfunctions in mice pdf
... response to western-type diet. Specifically, we foundthat apolipoprotein E3 knock -in mice fed western-type diet for 24 weeksbecame obese and developed hyperglycemia, hyperinsulinemia, hyperleptin-emia, ... the 24-week period of feeding mice withwestern-type diet, fasting plasma samples were takenevery 6 weeks, and cholesterol, triglyceride and freefatty acid levels were measured as described in Experimental ... appeared to be morepotent than mouse ApoE in promoting obesity in response to western-type diet. Furthermore, LDLr)/) mice were more sensitive to the development of diet-induced obesity and insulin...
- 14
- 378
- 0
Báo cáo khoa học: Apolipoprotein E-derived antimicrobial peptide analogues with altered membrane affinity and increased potency and breadth of activity pdf
... Authors Journal compilation ª 2007 FEBS Apolipoprotein E-derived antimicrobial peptide analogues with altered membrane affinity and increased potency and breadth of activity Bridie A. Kelly1, Stuart ... thecontribution of individual residues, and show that sub-stitutions for aromatic residues increase potency and breadth of activity, giving rise to further apoE-derived antimicrobial peptides (apoE-AMPs). ... Wozniak, and KeithCrutcher for review of the manuscript, and AndrewDoig for discussion of peptide CD and structural data.C.B.D. and B.A.K. were supported by grants fromUMIP Ltd, and the Manchester...
- 15
- 317
- 0
báo cáo hóa học:" Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasis" docx
... AccessResearch Three-dimensional growth as multicellular spheroid activates the proangiogenic phenotype of colorectal carcinoma cells via LFA-1-dependent VEGF: implications on hepatic micrometastasisMaría ... hour of incubation of monolayer- and 3D -spheroid- culturedCT26 cells. For both culture conditions, the concentration of VEGF was expressed as a function of the total numberJournal of Translational ... pro-metastatic role of this selected ensemble of proteins associated to the 3D -growth of CT26 colorectal carcinoma cells. ConclusionThis study demonstrates that culture of CT26 cancer cells as multicellular...
- 12
- 419
- 0
báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot
... mitotic kinase Aurora- A to be overexpressed in ovarian carcinomas compared to adenomas. Furthermore, we demonstrated the pan- Aurora inhibitor VE-465 can synergize with paclitaxel to induce apoptosis ... purposes)Journal of Translational MedicineOpen AccessResearch Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cellsChristopher D Scharer1,2, Noelani Laycock1, ... are specific to Aurora- A, VE-465 synergizes with paclitaxel to induce 4.5-fold greater apoptosis than paclitaxel alone in 1A9 cells. Higher doses are needed to induce apoptosis in paclitaxel- resistant...
- 13
- 475
- 0
báo cáo hóa học:" Mass spectrometry-based serum proteome pattern analysis in molecular diagnostics of early stage breast cancer" pdf
... preprocessing of data that included averaging of tech-nical repeats, interpolation of missing or non-alignedpoints, binning of neighboring points to reduce data com-plexity, removal of the spectral ... resolu-tion of the analyzer operating in the linear mode or mightresult in overlapping of ions originating from protein/peptides of very similar molecular masses. In addition,because of technological ... 1 of 13(page number not for citation purposes)Journal of Translational MedicineOpen AccessResearch Mass spectrometry-based serum proteome pattern analysis in molecular diagnostics of early...
- 13
- 506
- 0
Báo cáo hóa học: " Toll-like receptor 9 polymorphisms influence mother-to-child transmission of human immunodeficiency virus type 1" pptx
... upon the risk of mother-to-child transmission (MTCT) of Human Immunodeficiency Virus type 1 (HIV-1). The aim of this study was to investigate the influence of genetic variants of TLR 9 gene on MTCT.Methods: ... original work is properly cited.Research Toll-like receptor 9 polymorphisms influence mother-to-child transmission of human immunodeficiency virus type 1Elisabetta Ricci1, Sandro Malacrida2, ... MJ, Bochud PY: Polymorphisms in toll-like receptor 4 and toll-like receptor 9 influence viral load in a seroincident cohort of HIV-1-infected individuals. AIDS 20 09, 27:2387 -95 . 9. Barton GM,...
- 5
- 352
- 0
Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx
... using semi-nested primers. The primer setBG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) andBG2 (AATAACCTTATCCTCCTCTATAAAATAACC)were used in the first round and BG2 and BG5(GGTTGGTTAGTTTTGTTTTGATTAATAG) ... Open Access S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)Donald Lavelle1,2*, Yogen Saunthararajah1,3, Kestis Vaitkus1,2, Mahipal Singh1,2,5, ... S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis). Journal ofTranslational Medicine 2010 8:92.Lavelle et al. Journal of Translational Medicine 2010,...
- 8
- 443
- 0
Báo cáo hóa học: " Treatment combining RU486 and Ad5IL-12 vector attenuates the growth of experimentally formed prostate tumors and induces changes in the sentinel lymph nodes of mice" doc
... Access Treatment combining RU486 and Ad5IL-12 vector attenuates the growth of experimentally formed prostate tumors and induces changes in the sentinel lymph nodes of miceClaudia Raja Gabaglia1, Alexandra ... combining RU486 and Ad5IL-12 vector attenuates the growth of experimentally formed prostate tumors and induces changes in the sentinel lymph nodes of mice. Journal of Translational Medicine 2010 ... another indication for the inclusion of RU486 in therapy. Thus, the use of RU486 in prostate cancer therapy could have effects on cachexia, andro-gen-dependent tumor growth and as an adjuvant in immune...
- 10
- 773
- 0
Báo cáo hóa học: " Myocardium-derived conditioned medium improves left ventricular function in rodent acute myocardial infarction" pot
... Pharmacol Sin 2006, 27:1153-1158.doi:10.1186/1479-5876-9-11Cite this article as: Leu et al.: Myocardium-derived conditioned medium improves left ventricular function in rodent acute myocardial infarction.Journal ... Medicine 2011, 9:11http://www.translational-medicine.com/content/9/1/11Page 18 of 18RESEARCH Open Access Myocardium-derived conditioned medium improves left ventricular function in rodent acute ... Yip1,2*AbstractBackground: We investigated whether myocardium-de rived conditioned medium (MDCM) is effect ive in preserving left ventricular (LV) function in a rat acute myocardial infarction (AMI) model.Methods:...
- 18
- 342
- 0
báo cáo hóa học: " Apolipoprotein E-specific innate immune response in astrocytes from targeted replacement mice" pptx
... of NeuroinflammationOpen AccessResearch Apolipoprotein E-specific innate immune response in astrocytes from targeted replacement miceIzumi Maezawa1, Nobuyo Maeda2, Thomas J Montine1 ... role in protecting the brain during innate immune response. J Neu-rosci 2003, 23:5536-5544.25. Wenk GL, McGann-Gramling K, Hauss-Wegrzyniak B, Ronchetti D,Maucci R, Rosi S, Gasparini L, Ongini ... CD14-dependent innate immune response in vivo. J Neuroinflammation 2004, 1:20.29. Shie FS, Montine KS, Breyer RM, Montine TJ: Microglial EP2 is crit-ical to neurotoxicity from activated cerebral innate...
- 6
- 214
- 0
báo cáo hóa học: " Apolipoprotein E isoform-dependent dendritic recovery of hippocampal neurons following activation of innate immunity" pot
... the three TR APOE mice. Recovery of dendrite length over the next 48 hr was greater in TR APOE2 thanTR APOE3 mice, while TR APOE4 mice had failure of dendrite regeneration. Cell culture experiments ... demonstratedthat despite brain regional differences in apoE expression,there are no isoform-specific differences in levels of apoEin brain tissue from these TR APOE mice, even with ele-vated apoE2 ... APOE3, and greatest with TRAPOE4; these apoE isoform-dependent differences inparacrine damage to neurons are p38MAPK-dependent[39]. Primary astrocyte cultures from these same TR APOEmice show...
- 9
- 233
- 0
báo cáo hóa học: " Apolipoprotein E expression is elevated by interleukin 1 and other interleukin 1-induced factors" ppt
... cytokines is elevated, the expression of IL -1- driven AD-related proteins such as ApoE would be elevated as well. Multiple MLKs—ERK, p38-MAPK, and JNK—were shown to be involved in elevated expression ... made available soon. Apolipoprotein E expression is elevated by interleukin 1 and other interleukin 1- induced factorsJournal of Neuroinflammation 2 011 , 8 :17 5 doi :10 .11 86 /17 42-2094-8 -17 5Ling Liu ... **p<0. 01. Apolipoprotein E expression is elevated by interleukin 1 and other interleukin 1- induced factors Ling Liu 1 ; Orwa Aboud 1 ; Richard A Jones 1 ; Robert E Mrak4; W Sue T Griffin 1- 3*;...
- 27
- 276
- 0
Báo cáo hóa học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial cells" ppt
... of 9(page number not for citation purposes)Virology JournalOpen AccessResearchKaposi's sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular ... vGPCR induces COX-2expression in primary vascular endothelial cells and maybe responsible for the COX-2 and PGE2 increases observedfollowing infection in microvascular endothelial cells and in ... Chandran B: Cyclooxygenase 2 inducedby Kaposi's sarcoma- associated herpesvirus early during in vitro infection of target cells plays a role in the maintenance of latent viral gene expression....
- 9
- 327
- 0
Báo cáo hóa học: " Diffusion laws in dendritic spines" doc
... hypothesized to involve other mechanisms such as twitching. Thisidea was reinforced by the findings [8] that inside the spine, the cytoplasmic actin isorganized in filaments, involved in various forms ... model of protein trafficking in spines. Biophys.J. 96, 1786–1802 (2009)57. Bressloff, P.C.: Cable theory of protein receptor trafficking in dendritic trees. Phys. Rev. E, Stat.Nonlinear Soft Matter ... residence of cal-cium in spines [58–60] and it would be interesting to add them in the present analysis.Competing interestsThe authors declare that they have no competing interests.Authors’...
- 14
- 255
- 0
Báo cáo hóa học: "Gradient estimation in dendritic reinforcement learning" potx
... NMDA-spikescan arise in certain dendritic zones. In the context of reinforcement learning, twokinds of plasticity rules are derived, zone reinforcement (ZR) and cell reinforcement (CR), which ... second integration extending from time t into thefuture up to t + ∆. The acausality of integrating into the future can be takencare of by time shifting the integration variable in the first line ... faster learning. A simple and well-knownexample for this is adjusting the reinforcement baseline by choosing a constantc and replacing R(Z, X) with R(Z, X) + c in (10); this amounts to adding c11Fig....
- 38
- 286
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quotbài báo cáo môn học hóa vô cơ nâng caohoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ