báo cáo hóa học: " Effect of pioglitazone treatment in a patient with secondary multiple sclerosis" doc
báo cáo hóa học: " Effect of exacerbations on health status in subjects with chronic obstructive pulmonary disease" doc
... frequency of acute exac-erbations and also reduced the rate of decline in thehealth status, since frequent exacerbations were associated with a more rapid rate of deterioration in health status[13-15]. ... the data and prepared the initial manuscript.MT, TH, AI, HK and TO participated in data collection andthe care for the participants. SS and TO performed the sta-tistical analysis. All authors ... Co.Ltd., Osaka, Japan) which was calibrated with a 3.0 Lsyringe. The FEV1 and FVC were assessed before, and at 15and 60 minutes after the inhalation of bronchodilators(80 μg of ipratropium...
- 8
- 594
- 0
báo cáo hóa học: " Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf
... drafting of manuscript. RL: coordination of thestudy, gathering and processing of data (questionnaires),performed the statistical analyses, drafting and revising of manuscript. JH: participated ... 37:227-236.32. Janse AJ, Gemke RJBJ, Uiterwaal CS, Tweel I Van der, Kimpen JLL, Sin-nema G: Quality of life; patients and doctors don't alwaysagree: A meta analysis. Journal of Clinical Epidemiology ... rapid and intensive changes in QoL, mood andbehaviour during ALL therapy. [13,15]The aim of this study was to assess the effect of dexameth-asone on QoL during maintenance treatment in childrenwith...
- 8
- 474
- 0
Báo cáo hóa học: " Effect of terminal accuracy requirements on temporal gaze-hand coordination during fast discrete and reciprocal pointings" doc
... dataacquisition and analysis and drafting of the manuscript. NF and NTevaluated the data and participated to the manuscript writing. FB, MGR andML participated to data acquisition and analysis. All authors ... the case, an increased visual processing relativeto the final phase of the preceding movement could beassociated with a gaze-hand lead magnitude stabilizationby means of a dwell time increase ... vicinity of the tar-get during hand deceleration. Such a gaze-hand leadpattern is naturally assumed to allow (i) the early update of the initial hand motor plan on the basis of acc uratetarget...
- 12
- 502
- 0
Báo cáo hóa học: " Effect of visual distraction and auditory feedback on patient effort during robot-assisted movement training after stroke" ppt
... rsecoli@uci.edu2Biomechatronic Lab., Departments of Mechanical and AerospaceEngineering, University of California, 4200 Engineering Gateway, Irvine, CA92697-3875 Irvine, USAFull list of author information is available ... during a standard robot-assisted movement trainingtask. This effect was greater for the hemiparetic arm, suggesting that the increased demands associated with controlling an affected arm make ... or lack of k inematic variability in training.These are recently documented for chronic strokepatients who were ambulatory at the start of robotictraining [12]. In the extreme, if a patient...
- 10
- 609
- 0
báo cáo hóa học: "Effect of auditory feedback differs according to side of hemiparesis: a comparative pilot study" pdf
... each variable analyzedIndividual kinematic data in RHD and LHD patient groups with and without feedbackFigure 4Individual kinematic data in RHD and LHD patient groups with and without feedback. ... ischemic, Haem = haemorrhagic, Apraxia(+) = mild, Apraxia(++) = interferes with ADL, Aphasia score according to the Boston Diagnostic Aphasia Examination.Journal of NeuroEngineering and Rehabilitation ... demonstrate loss of motor control andfunction and altered kinematic parameters of reaching movements. Feedback is an essentialcomponent of rehabilitation and auditory feedback of kinematic parameters...
- 11
- 578
- 0
báo cáo hóa học: "Effect of obesity and low back pain on spinal mobility: a cross sectional study in women" pptx
... study, participated in data collection and analysis, andmanuscript writing; FM participated in data analysis, statistical analysis andmanuscript writing; FZ participated in the definition of criteria ... under any treatment. cLBP patients were definedaccording to clinical examination and duration of pain[40-42], and all of them performed an X-ray to exclude secondary cLBP. The study has been approved ... Clinical Lab for Gait Analysis andPosture, Ospedale San Giuseppe, Istituto Auxologico Italiano, IRCCS, ViaCadorna 90, I-28824, Piancavallo (VB), ItalyVismara et al. Journal of NeuroEngineering and...
- 8
- 602
- 0
báo cáo hóa học:" Regression of orthotopic neuroblastoma in mice by targeting the endothelial and tumor cell compartments" pdf
... not separated into stages 4 and 4S since 4S is for infantsINSS (International Neuroblastoma Staging System) according to Simpson and Gaze [27] at autopsyJournal of Translational Medicine 2009, ... was analyzed by MS. RC contributed with datainterpretation and drafting of the manuscript written byDF and FA. EL and MS provided input in writing of themanuscript. All authors read and approved ... was administered once as postoperative analgesia.All handling of the animals was performed under asepticconditions.Nine weeks after xenografting, all animals (n = 35)showed establishment of...
- 11
- 593
- 0
Báo cáo hóa học: " Detection of epithelial apoptosis in pelvic ileal pouches for ulcerative colitis and familial adenomatous polyposis" pot
... Pouchitisand extraintestinal manifestations of inflammatory bowel disease afterileal pouch-anal anastomosis. Ann Surg 1990, 211(5):622-629.15. Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients with ... fact that both inflammatory and apoptosispathways are related.Furthermore, the major pathway of apoptosis in these cases were intrinsic mitochondrial pathway char-acterized by APAF-1 and Caspase-9 ... N, Isozaki K, Kitamura S, Kondo S,Miyagawa J, Kanayama S, Shinomura Y, Ishikawa H, Ohtani T, Nezu R,Nagata S, Matsuzawa Y: High Fas ligand expression on lymphocytes in lesions of ulcerative...
- 6
- 407
- 0
Báo cáo hóa học: " Overexpression of microRNA-206 in the skeletal muscle from myotonic dystrophy type 1 patients" docx
... Utrophin was taken from Arning etal. [29] (Forward 5' aaggacctggtcaacgttcca 3', Reverse 5'acccgtgtcatagacattgagca 3'). The Beta-Actin mRNA levelwas used as control for normalization ... normalization of samples (For-ward 5#8242; gacaggatgcagaaggagattact 3', Reverse5#8242; tgatccacatctgctggaaggt 3').Nothern Blot analysisGiven the limited amount of RNA available, total ... 4373161), hsa-Gambardella et al. Journal of Translational Medicine 2010, 8:48http://www.translational-medicine.com/content/8/1/48Page 7 of 9The main goal of this paper was to investigate thepathophysiological...
- 9
- 444
- 0
Báo cáo hóa học: " Impact of g-chain cytokines on EBV-specific T cell cultures" doc
... board of theIstituto Oncologico Veneto, in accordance with the ethi-cal standards of Helsinki Declaration.Cyclosporin A (CsA, Sandoz Pharmaceuticals AG;Cham, Switzerland) was initially added ... involved in cytotoxicity. CD4+T cell line cytotoxicity wasevaluated in the presence of CMA and EGTA that block perforin-based pathway, and BFA and anti-FasL mAb that interfere with Fas/FasL-basedpathway. ... Italian Association for Cancer Research (AIRC).Author details1University of Padova, Dept. of Oncology and Surgical Sciences, ViaGattamelata 64, 35128 Padova, Italy.2Department of Haematology,...
- 8
- 453
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP