báo cáo hóa học: "Influence of a portable audio-biofeedback device on structural properties of postural sway" potx

báo cáo hóa học:" Double disadvantage: a case control study on health-related quality of life in children with sickle cell disease" potx

báo cáo hóa học:" Double disadvantage: a case control study on health-related quality of life in children with sickle cell disease" potx

... on demo graphic characteristics. As demographic charac ter- istics of the Dutch norm population of the KIDSC- REEN-52 were not available, data on marital status, educational level, and employment ... disadvan tage: a chronic disease, on top of an unfavourable background. Declaration of competing interests The authors declare that they have no competing interests. Hijmans et al...
Ngày tải lên : 20/06/2014, 15:20
  • 8
  • 466
  • 0
Báo cáo hóa học: " Research Article A Cohen Type Inequality for Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product" potx

Báo cáo hóa học: " Research Article A Cohen Type Inequality for Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product" potx

... Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product Bujar Xh. Fejzullahu 1 and Francisco Marcell ´ an 2 1 Department of Mathematics, Faculty of Mathematics and Natural ... Mart ´ ınez-Finkelshtein, J. J. Moreno-Balc ´ azar, and H. Pijeira-Cabrera, “Strong asymptotics for Gegenbauer-Sobolev orthogonal polynomials,” Journal of Computational and...
Ngày tải lên : 21/06/2014, 07:20
  • 22
  • 322
  • 0
Báo cáo hóa học: " Research Article A Strong Limit Theorem for Weighted Sums of Sequences of Negatively Dependent Random Variables" potx

Báo cáo hóa học: " Research Article A Strong Limit Theorem for Weighted Sums of Sequences of Negatively Dependent Random Variables" potx

... limit properties of independent or NA random variables to the case of ND variables is highly desirable and of considerably significance in the theory and application. Strong convergence is one of ... referees and the editors for their valuable comments and some helpful suggestions that improved the clarity and readability of the paper. This 2 Journal of Inequalities and Applicati...
Ngày tải lên : 21/06/2014, 07:20
  • 8
  • 326
  • 0
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

... TCGTATTCATACACCGTAC PEx1F CCAATTGCGCTACGCTCCT DNA-shift assay P SEx1 PEx1R CCATGTAGGCGGTGACGA simA7F TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift ... TAGAATTCATCGCCACGACCATG DNA-shift assay P R1 SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3 simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCG...
Ngày tải lên : 21/06/2014, 17:20
  • 12
  • 454
  • 0
báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf

báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf

... load balancing when a node exceeds its storage. The main logical components in PARIS are on- demand data transfer, runtime update of near likely node (for efficient data retrieval), and adaptive adjustment ... the approaches of global data storage in which the wireless device data is aggregated to be stored at external central servers, algorithms of local infor- mation processing [8]...
Ngày tải lên : 21/06/2014, 18:20
  • 17
  • 362
  • 0
báo cáo hóa học:" Research Article A New Multithreaded Architecture Supporting Direct Execution of Esterel" docx

báo cáo hóa học:" Research Article A New Multithreaded Architecture Supporting Direct Execution of Esterel" docx

... Systems Reset a0 0 a1 1 a0 1 a1 0 a1 2 a2 3 a3 4 a4 3 a4 2 a3 2 a3 1 a2 1 a2 0 a3 0 a4 1 a4 0 a2 2 a3 3 a4 4 A0 A1 A2 A3 A4 (a) State Description: A0 : Abort empty (no ABORT loaded) A1 : Abort Level 1 (AASR1 and AAAR1 loaded ... 1st ABORT) A2 : Abort Level 2 (AASR2 and AAAR2 loaded with 2nd ABORT) A3 : Abort Level 3 (AASR3 and AAAR3 loaded with 3rd ABORT) A4 :...
Ngày tải lên : 21/06/2014, 20:20
  • 19
  • 343
  • 0
Báo cáo hóa học: " Research Article A Hybrid Projection Algorithm for Finding Solutions of Mixed Equilibrium Problem and Variational Inequality Problem" pptx

Báo cáo hóa học: " Research Article A Hybrid Projection Algorithm for Finding Solutions of Mixed Equilibrium Problem and Variational Inequality Problem" pptx

... points of nonlinear mappings in Hilbert space,” Journal of Mathematical Analysis and Applications, vol. 20, pp. 197–228, 1967. 3 F. E. Browder, “Nonexpansive nonlinear operators in a Banach space,” ... Chadli, Z. Chbani, and H. Riahi, “Equilibrium problems with generalized monotone bifunctions and applications to variational inequalities,” Journal of Optimization Theory and Applicat...
Ngày tải lên : 21/06/2014, 20:20
  • 19
  • 451
  • 0
Báo cáo hóa học: " Research Article A New Achievable Rate and the Capacity of Some Classes of Multilevel Relay Network" potx

Báo cáo hóa học: " Research Article A New Achievable Rate and the Capacity of Some Classes of Multilevel Relay Network" potx

... X N  . (42) 6. A CLASS OF ORTHOGONAL RELAY NETWORKS In this section, we introduce a class of orthogonal relay networks that is a generalization of orthogonal relay channel [5]. First, we define orthogonal ... above rate is obtained as a special case of parity- forwarding method in which each relay selects the message of the previous relay, and it is stated that (38) is the c...
Ngày tải lên : 21/06/2014, 22:20
  • 10
  • 318
  • 0
Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

... Silverman and R. Linsker, A measure of DNA periodic- ity,” Journal of Theoretical Biology, vol. 118, no. 3, pp. 295–300, 1986. [23] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya, and ... parameter available for real-time control, so that a biologist viewing a periodicity characterization of a sequence might subjectively assign a relative weight to each of the...
Ngày tải lên : 22/06/2014, 00:20
  • 8
  • 382
  • 0
Báo cáo hóa học: " Research Article A Nonlinear Decision-Based Algorithm for Removal of Strip Lines, Drop Lines, Blotches, Band Missing and Impulses in Images and Videos" docx

Báo cáo hóa học: " Research Article A Nonlinear Decision-Based Algorithm for Removal of Strip Lines, Drop Lines, Blotches, Band Missing and Impulses in Images and Videos" docx

... EURASIP Journal on Image and Video Processing filtering. Additionally, impulse noise is a standard type of degradation in remotely sensed images. This paper considers application of median-based ... blotches as impulsive with constant intensity having irregular shapes. Kokaram [5]has given a method for removal of scratches and restoration of missing data in the image sequences ba...
Ngày tải lên : 22/06/2014, 00:20
  • 10
  • 288
  • 0

Xem thêm

Từ khóa: