Báo cáo hóa học: " Abnormal joint torque patterns exhibited by chronic stroke subjects while walking with a prescribed physiological gait pattern" pdf

Báo cáo hóa học: " Abnormal joint torque patterns exhibited by chronic stroke subjects while walking with a prescribed physiological gait pattern" pdf

Báo cáo hóa học: " Abnormal joint torque patterns exhibited by chronic stroke subjects while walking with a prescribed physiological gait pattern" pdf

... citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research Abnormal joint torque patterns exhibited by chronic stroke subjects while walking with a prescribed physiological ... being similar, stroke subjects still generated abnormal joint torque patterns, particularly in the impaired limb. Many of these abnor- mal pattern...
Ngày tải lên : 19/06/2014, 08:20
  • 13
  • 359
  • 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-AGGGCGGGGGCATCGGGCACCGGGAT- GGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC- GACAGCAAGCGAACCGGAAT-3' and 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAAC- CGGGTTTATTTCCTAAAAT GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCG- GAAATGTTGAATACTCA TACTCTTCCTTTTTC-3'. ... (5'-cttgctggacgcagagcacta-3') and UL8-r (5'- gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5&...
Ngày tải lên : 20/06/2014, 01:20
  • 13
  • 463
  • 0
báo cáo hóa học:" The treatment of scaphoid nonunion using the Ilizarov fixator without bone graft, a study of 18 cases" pdf

báo cáo hóa học:" The treatment of scaphoid nonunion using the Ilizarov fixator without bone graft, a study of 18 cases" pdf

... 50(3):217-24. 19. Malizos KN, Zachos V, Dailiana ZH, Zalavras C, Varitimidis S, Hantes M, Karantanas A: Scaphoid nonunions: management with vascularized bone grafts from the distal radius: a clinical and functional ... 2002, 84 -A( 6):915-20. 18. Dailiana ZH, Zachos V, Varitimidis S, Papanagiotou P, Karantanas A, Malizos KN: Scaphoid nonunions treated with vascularised bone grafts: M...
Ngày tải lên : 20/06/2014, 07:20
  • 10
  • 378
  • 0
Báo cáo hóa học: " Wet chemical synthesis and magnetic properties of single crystal Co nanochains with surface amorphous passivation Co layers" pdf

Báo cáo hóa học: " Wet chemical synthesis and magnetic properties of single crystal Co nanochains with surface amorphous passivation Co layers" pdf

... Properties of nearly monodisperse CoFe2O4 nanoparticles through a simple hydrothermal condition. Nanoscale Res Lett 2010, 5:1039. 12. Narayanan T, Shaijumon M, Ajayan P, Anantharaman M: Synthesis ... saturation magnetization. Nanoscale Res Lett 2010, 5:1718. 5. Cao H, Xu Z, Sang H, Sheng D, Tie C: Template synthesis and magnetic behavior of an array of cobalt nanowires encapsulated in polya...
Ngày tải lên : 21/06/2014, 04:20
  • 5
  • 465
  • 0
Báo cáo hóa học: " Research Article Inclusion Properties for Certain Classes of Meromorphic Functions Associated with a Family of Linear Operators" pptx

Báo cáo hóa học: " Research Article Inclusion Properties for Certain Classes of Meromorphic Functions Associated with a Family of Linear Operators" pptx

... functions associated with the Choi-Saigo-Srivastava operator,” Journal of Mathematical Analysis and Applications, vol. 320, no. 2, pp. 779–786, 2006. 17 R. W. Barnard and Ch. Kellogg, “Applications ... functions,” SIAM Journal on Mathematical Analysis, vol. 15, no. 4, pp. 737–745, 1984. 8 K. I. Noor and M. A. Noor, “On integral operators,” Journal of Mathematical Analysis and Applicati...
Ngày tải lên : 21/06/2014, 20:20
  • 12
  • 290
  • 0
Báo cáo hóa học: " Abnormal coactivation of knee and ankle extensors is related to changes in heteronymous spinal pathways after stroke" pot

Báo cáo hóa học: " Abnormal coactivation of knee and ankle extensors is related to changes in heteronymous spinal pathways after stroke" pot

... thus may contribute to abnormal patterns of muscle activation. It has been suggested that an enlargement of the cortical areas activated during volun- tary tasks may participate in the abnormal ... the accomplishment of a dynamic task s uch as gait. Knee and ankle extensors are both anti-gravity muscles that have a usual out-of-phase reciprocal activa- tion during gait with qua...
Ngày tải lên : 19/06/2014, 08:20
  • 14
  • 546
  • 0
Báo cáo hóa học: " Leg joint power output during progressive resistance FES-LCE cycling in SCI subjects: developing an index of fatigue" doc

Báo cáo hóa học: " Leg joint power output during progressive resistance FES-LCE cycling in SCI subjects: developing an index of fatigue" doc

... CT, USA Email: Stephenie A Haapala - sahaapala@gmail.com ; Pouran D Faghri* - pouran.faghri@uconn.edu; DouglasJAdams-dadams@nso.uchc.edu * Corresponding author †Equal contributors Abstract Background: ... SCI subjects: developing an index of fatigue Stephenie A Haapala †1,2 , Pouran D Faghri* †1,2 and Douglas J Adams 3 Address: 1 Functional Performance Laboratory, Department of Allied...
Ngày tải lên : 19/06/2014, 08:20
  • 12
  • 373
  • 0
báo cáo hóa học:" Acromioclavicular joint dislocation: a comparative biomechanical study of the palmaris-longus tendon graft reconstruction with other augmentative methods in cadaveric models" docx

báo cáo hóa học:" Acromioclavicular joint dislocation: a comparative biomechanical study of the palmaris-longus tendon graft reconstruction with other augmentative methods in cadaveric models" docx

... relation to the distal aspect of the clavicle. Operative treatment has been advocated for certain type III acromioclavicular joint separations and certainly in types IV and V acromioclavicular joint ... 1999, 27:35-43. 25. Mazzocca AD, Santangelo SA, Johnson ST, Rios CG, Dumonski ML, Arciero RA: A biomechanical evaluation of an anatomical coracoclavicular ligament reconstruction. Am J S...
Ngày tải lên : 20/06/2014, 01:20
  • 10
  • 738
  • 0
báo cáo hóa học:" Finger joint motion generated by individual extrinsic muscles: A cadaveric study" doc

báo cáo hóa học:" Finger joint motion generated by individual extrinsic muscles: A cadaveric study" doc

... tendon was loaded to 10% of its force potential and the motion generated at the metacarpophalangeal (MCP), proximal interphalangeal (PIP), and distal interphalangeal (DIP) joints was simultaneously ... fingers: arrangement and variations – II. Clin Anat 1995, 8:391-398. 15. Hirai Y, Yoshida K, Yamanaka K, Inoue A, Yamaki K, Yoshizuka M: An anatomic study of the extensor tendons of the human...
Ngày tải lên : 20/06/2014, 01:20
  • 7
  • 194
  • 0
Báo cáo hóa học: " Fabrication of HfO2 patterns by laser interference nanolithography and selective dry etching for III-V CMOS application" pdf

Báo cáo hóa học: " Fabrication of HfO2 patterns by laser interference nanolithography and selective dry etching for III-V CMOS application" pdf

... interpretatio n of data, and drafted the manuscript. BG carried out the TEM characterization and participated in the interpretation of the data. JMMA carried out the TEM sample preparation and analysis. ... rinse was applied to clean the exposed GaAs bottom trenches. The s urface morphology of the patterned HfO 2 /GaAs samples was examined with an AFM microscope (5500 Agilent, Santa Cla ra,...
Ngày tải lên : 21/06/2014, 03:20
  • 6
  • 459
  • 0

Xem thêm

Từ khóa: