0
  1. Trang chủ >
  2. Kỹ Thuật - Công Nghệ >
  3. Điện - Điện tử >

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo y học:

Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

... 6. Tanaka A, Abe T, Matsuura A. Prevention of postoperative intrapleural adhesion of the thoracotomy incision by a biore-sorbable membrane in the rat adhesion model. Ann Thorac Cardiovasc ... Research Paper Prevention of Pleural Adhesions Using a Membrane Containing Polyeth-ylene Glycol in Rats Volkan Karacam1, Ahmet Onen2, Aydin Sanli2, Duygu Gurel3, Aydanur Kargi3, Sami ... of the Hematoxylin-Eosin stained sections (Figure 2A and 2B). Figure 1. Macroscopic images of the rats. A: Appearance of the visceral pleura after abrasion with dry and iodinated spanch....
  • 7
  • 453
  • 0
Tài liệu Báo cáo khoa học: Prevention of thermal inactivation and aggregation of lysozyme by polyamines docx

Tài liệu Báo cáo khoa học: Prevention of thermal inactivation and aggregation of lysozyme by polyamines docx

... measuring the absorbance (A) at600 nm. The rate constant of inactivation was determinedby fitting the data to a linear extrapolation.CD spectraFar-ultraviolet CD spectra were measured using a ... Kentaro Shiraki1, Shinsuke Fujiwara2, Tadayuki Imanaka3and Masahiro Takagi11School of Materials Science, Japan Advanced Institute of Science and Technology, Ishikawa, Japan;2Department ... the aggregation and inactivation of proteins ishard to determine.3Arginine (Arg) is a nondenaturing reagent that has beenused widely as an additive to prevent protein aggregation[9–12]. Arg...
  • 8
  • 557
  • 0
Báo cáo y học:

Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"

... 5′-TGTCTCGTGTTACAGGCGGGGT-3', asymmetric primer 2 was 5′-GAGGCATAGCAGCAGGA GAAGAG-3', and fluorescent primer was 5′-TCGCTGGAAGTGTCTGCGGCGT-3'. Serum assays Fasting blood was collected ... recruited into this study. The levels of fasting blood glucose (FBG), fasting insulin (FINS), triglyceride (TG), cholesterol (CHOL), alanine amino-transferase (ALT), aspartate aminotransferase (AST), ... glucose (FBG), insulin, triglyceride (TG), cholesterol (CHOL), ALT, aspartate amino-transferase (AST), γ-glutamyltransferase (GGT), alka-line phosphatases (ALP), albumin (Alb) and globulin (Glb)...
  • 6
  • 606
  • 0
Báo cáo y học:

Báo cáo y học: "Management of HBV Infection in Liver Transplantation Patients"

... the American Association for the Study of Liver Diseases as past Chairman of both the Training and Education and thePublications Committees. He is also a past councilor of the International ... Transplantation at Cedars-Sinai Medical Center. His basic and translational research interests involve the immunological and inflammatory mechanisms of pathogenesis in alloimmune and autoimmune ... donor had been immunized against hepatitis B [92]. Vaccination After Transplantation: The prospect of generating active immunity against HBsAg epitopes remains an intriguing strategy that could...
  • 9
  • 671
  • 0
Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx

Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx

... response.AbbreviationsALT, alanine aminotrasferase; AST, aspartate aminotrasferase; CLP, cecal ligation and puncture; CYP, cytochrome P450; GdCl3, gadoliniumchloride; GSH, glutathione; GSSG, glutathione ... using a digitalcamera (DC120; Eastman Kodak, New Haven, CT, USA)and densitometric scanning analysis software (1d main;Advanced American Biotechnology, Fullerton, CA, USA).Statistical analysisAll ... (bp)CD163(XM_053094.2)Sense:AGCTGGGCTGTGCAGACAACGAntisense:TGAATGACCCCCGAGGATTTCAGC736CYP 1A1 (X00469)Sense:CTGGTTCTGGATACCCAGCTGAntisense:CCTAGGGTTGGTTACCAGG331CYP 1A2 (X01031)Sense:CAGTCACAACAGCCATCTTCAntisense:CCACTGCTTCTCATCATGGT302CYP2B1(XM_342078)Sense:TTGTTTGGTGCTGGGACAGAGAntisense:GGCTAGGCCCTCTCCTGCACA443CYP2E1(M20131)Sense:AAACTTCATGAAGAAATTGACAntisense:TCTCCAACACACACACGCTTTCC311TNF -a (X66539)Sense:GTAGCCCACGTCGTAGCAAAAntisense:CCCTTCTCCAGCTGGAAGAC346IL-6(NM_012589)Sense:GAAAGTCAACTCCATCTGCCAntisense:CATAGCACACTAGGTTTGCC678b-actin(BC063166)Sense:TTGTAACCAACTGGGACGATATGGAntisense:GATCTTGATCTTCATGGTGCTAG764T...
  • 11
  • 769
  • 0
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

... Horse-radish peroxidase-conjugated antibody against caspase-3(#610325) was from BD Pharmigen, and antibody againstb-actin (A5 441) was from Sigma.Statistical analysisAll data are expressed as ... examinedthe main steps involved, following the uptake of satu-rated and unsaturated FFAs into the cells. After theirinternalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed ... monounsaturated long -chain fatty acids in pan-creatic beta-cells. J Endocrinol 194, 283–291.16 Cunha DA, Hekerman P, Ladriere L, Bazarra-Castro A, Ortis F, Wakeham MC, Moore F, Rasschaert J,Cardozo...
  • 12
  • 721
  • 0
Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx

Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx

... GCCGCCACCATGCACCATCACCATCACCATCACCATCACCATCAATCAGACATTGCGCAAGGAAAGAAGTCCp1(r) GGCCACTATCGATGCATCAGATG ClaIp2(f) CATCTGATGCATCGATAGTGGCC ClaIp2(r) GTGTTTGGGCCGAGTGGGAT BamHIbp3(f) GCCATTGATTCGTCCGACTA BamHIbp3(r) ... GGCACTAGTATGCAATCAGACATTGCG SpeIpK47 3A( mut) CCATCAGGAAGCGGCGCATCAACAATTG CGTCTTTGpE599Q(mut) CTTATTTTAGATCAAGCAACCAGTGCCpH 631 A( mut) CTATATCAATTGCAGCGAGGCTTTCGACGpC257S(mut) AAATTGACTTCCGTAATGATGpC464S(mut) ... basesunderlined).Primer Sequence Site a p1(f) GGTACCACTAGTGCCGCCACCATGGTTGTAAGAAT KpnI, SpeI, NcoIGATACGTCTTTGTAAAGGp1B(f) GCCGCCACCATGCAATCAGACATTGCGCAAGGAAAGAAGTCCp1C(f) GCCGCCACCATGCACCATCACCATCACCATCACCATCACCATCAATCAGACATTGCGCAAGGAAAGAAGTCCp1(r)...
  • 13
  • 615
  • 0
Tài liệu Báo cáo khoa học: Role of ceramide kinase in peroxisome proliferatoractivated receptor beta-induced cell survival of mouse keratinocytes ppt

Tài liệu Báo cáo khoa học: Role of ceramide kinase in peroxisome proliferatoractivated receptor beta-induced cell survival of mouse keratinocytes ppt

... 5¢-GTAGGCATGAGAACGGGAAG-3 and for reverse 5¢-GGGGGTAAGAGGAGGAGAAA-3¢ and for CERK-negative forward 5¢-CCGCAAGAGGCTTTATTGTC-3 and reverse 5¢-TATGCCAAGGACACGGAGAT-3¢, as a negative control ... MEBCYTO Apoptosis Kit waspurchased from Medical and Biological Laboratories(Nagoya, Japan), and a Nuclear Extract Kit was fromActive Motif (Carlsbad, CA, USA). The ChIP Assay Kitwas also a product ... mitogen-activated proteinkinase and phosphatidylinositol 3-kinase-mediatedphosphorylation. This pathway results in cholangiocar-cinoma cell growth. CerK has also been reported toact as an upstream...
  • 12
  • 698
  • 0
Báo cáo khoa học: Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus pptx

Báo cáo khoa học: Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus pptx

... domain, an AAA+ module (AAA-1), a middle domain, and a secondAAA+ module (AAA-2). Each AAA+ module contains highly conservedWalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine(AAA-2). ... Authors Journal compilation ª 2011 FEBS 2397Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilusTakashi Yamasaki1, Yosuke Nakazaki1, Masasuke ... Motoyama-Kamigamo, JapanIntroductionThe expanded superfamily of ATPases associated withdiverse cellular activities (AAA+) are involved in a variety of cellular activities, including membranefusion,...
  • 9
  • 410
  • 0
Báo cáo khoa học: Involvement of lysine 1047 in type I collagen-mediated activation of polymorphonuclear neutrophils doc

Báo cáo khoa học: Involvement of lysine 1047 in type I collagen-mediated activation of polymorphonuclear neutrophils doc

... antiplasminvariants as studied by surface plasmon resonance.Biochim Biophys Acta 1764, 1730–1734.16 Wang H, Yu A, Wiman B & Pap S (2003) Identification of amino acids in antiplasmin involved ... specificamino acids in protein–protein interactions. Forinstance, selective carbamylation of the a- amino group of the tissue inhibitor of metalloproteinases-2 NH2-ter-minal cysteine has been ... peptide was crucial in thePMN activation process and represented a preferentialtarget of carbamylation.To localize this residue, we analyzed primarysequences of a collagen a 1 chain of various...
  • 10
  • 519
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM