Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
... 9:127http://www.translational-medicine.com/content/9/1/127Page 3 of 15RESEARCH Open AccessThe immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s diseaseHayk Davtyan1,2, Anahit Ghochikyan1, ... Richard Cadagan3, Dmitriy Zamarin3, Irina Petrushina2, Nina Movsesyan2,Luis Martinez-Sobrido4, Randy A Albrecht3,5, Adolfo Garc a- Sastre3,5,6 and Michael G Agadjanyan1,2*AbstractBackground: ... yearly and the safety of this vaccine is observed for a long period of time, the chance thatthe dual vaccine is safe is very high. Finally, we thinkthat the availability of a safe dual vaccine...
- 15
- 431
- 0
Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx
... compartments, while theTable 1: Domain Mutation Name WT aa Sequence Mut. aa SequenceI CL38 YGT AGAICL49YSRAAAI Y3 8A YGT AGTIY49AYSRASRI CL38-CL49 YGT-YSR AGA-AAAI Y3 8A- Y4 9A YGT-YSR AGT-ASRICL61SKRSKAIV ... complementation for infectious virus productionresults shown in figure 2.Intracellular transport and TGN localization of UL20p mutants and gKTransport and localization of UL20p and gK was furtherassessed ... localization. J Virol 2004,78(23):13262-13277.32. Alconada A, Bauer U, Hoflack B: A tyrosine-based motif and a casein kinase II phosphorylation site regulate the intracellu-lar trafficking of...
- 12
- 526
- 0
Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf
... tropicalAfrica and Madagascar island) and the lineage I (tropicalafrican strains) that caused the outbreaks of WNV infec-tion in North Africa, Europe, Israel, and in the UnitedStates. Nucleotide ... serum and a FITC-conjugated second-ary antibody, green staining) and neuronal specific enolase (using a rabbit polyclonal antiserum and an anti-rabbit polyclonal antibody made in goat conjugated ... wereinoculated with 1,000 FFU of WNV via different routes(15 animals per group): intraperitoneal (i.p.), intradermal(i.d.), intracerebral (i.c.), and intranasal (i.n.). At Days 5 and 7 of infection,...
- 5
- 403
- 0
Báo cáo sinh học: " The 3'''' sequences required for incorporation of an engineered ssRNA into the Reovirus genome" pot
... 150CUA CGC CUG AAU AAG UGA UAA UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUCGAGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAGCUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU ... UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUCGAGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAGCUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU G G G3’ G GAGGGAAUCGGAUGGCUUCAUCGGGUCCAGCCUGGCGCUCCUCCACCUCUACGGUACGGCUGGG CUACUUACACACCAGUCAGCACUCCACACACCCCCCUGGGGGAGUGAGGUUCUGCUAGUCUAUUCCCGACGUUAGCGCCGUGAUCAGCGGGGGCAUAAUGGAGCAHDV- ... CUA UCU UCA CAU CUA CUC CGA GCU GGU AAU UCA CCA UGG CAG UUA ACA CAG UUU UUA GAC UGG AUA AGC CUU GGG AGG GGU UUA GCU ACA UCG GCU CUC GUU CCG ACGACG GAU CCG AGA UUU5’(1) ST3 S2 5’ untranslated...
- 11
- 455
- 0
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... inMaputo, with the aim of identifying their social and geo-graphical origins and their expectations and difficultiesregarding their education and professional future.Methods A piloted, standardized ... peri-ods, in April and May of 1999 (see Figure 2).All data were entered into an Access database and ana-lysed using SPSS. The statistical analysis is mostly descrip-tive.Two hundred and twenty-seven ... it and 20% did nothave any opinion.Regarding the quality of the training received, 52% felt itwas adequate or very adequate, 20% that it was inade-quate or very inadequate and the remainder...
- 7
- 493
- 0
báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx
... Government of Malawi, Ministry of Health and Population: MalawiNational Health Accounts: a broader perspective of theMalawian Health Sector. 2001.20. Government of Malawi, Ministry of Health and ... .26. Harries AD, Hargreaves NJ, Kwanjana JH, Gausi F, Kwanjana JH,Salaniponi FM: High death rates in health care workers and teachers in Malawi, Transactions of Royal Society of TropicalMedicine ... Government of Malawi, Ministry of Health and Population: MalawiHealth Facility Survey. 2003.18. Government of Malawi, Ministry of Health and Population: NationalTuberculosis Programme Annual Report...
- 13
- 585
- 0
báo cáo sinh học:" The health worker recruitment and deployment process in Kenya: an emergency hiring program" doc
... build leadership and managementcapacity at all levels;▪ professionalizing HR departments and units and ensur-ing that HR staff have input into strategic decisions and HR innovations that will ... local labour market and patients with AIDS-related diseases can usually be discharged once they arestarted on ART and have been stabilized. The initialphases of the Emergency Hiring Program, ... performance of the health system;▪ development and support of HR leaders who have thecapacity to motivate, communicate, and lead change inorder to create commitment and a shared vision.Leadership...
- 3
- 481
- 0
báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
... Yasunaga - yasunagah@adm.h.u-tokyo.ac.jp; Tomoaki Imamura - imamurat@naramed-u.ac.jp* Corresponding author AbstractBackground: In Japan, physicians freely choose their specialty and workplace, ... Sciences, National Institute of Public Health, Saitama, Japan, 4Department of Health Management and Policy, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan and 5Department of ... and percentage of physicians changing specialties more thanonce. A comparison of average values between two classeswas performed by means of a t-test, and a comparison of rates between two classes was...
- 10
- 588
- 0
báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf
... and 5World Health Organization Country Office, Lusaka, ZambiaEmail: Annette Mwansa Nkowane* - nkowanemwansa@who.int; Liliane Boualam - boualaml@who.int; Salah Haithami - haithamis@sud.emro.who.int; ... Nkowane*1, Liliane Boualam2, Salah Haithami3, El Tayeb Ahmed El Sayed4 and Helen Mutambo5Address: 1Department of Human Resources for Health, World Health Organization, Geneva, Switzerland, 2Polio ... purposes)Human Resources for HealthOpen AccessResearchThe role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and ZambiaAnnette Mwansa Nkowane*1,...
- 8
- 628
- 0
báo cáo sinh học:" The course of specialization in public health in Rio de Janeiro, Brazil, from 1926 to 2006: lessons and challenges Monireh Obbadi" ppt
... a consequence of various factors including re-orga-nizations of the course, availability of places, varyinginterest in the field of public health as a career, and theavailability of scholarships.Originally, ... late 1970s, a change also occurred in thenature of the disciplines of the course. There was a gen-eral move away from biology and hygiene and towardsadministration, planning, management and ... infection and a belief that improved public health was a sign of pr ogress and modernization of the country.Within the Americas, the creation of the Pan-AmericanSanitary Bureau in 1902 and the...
- 5
- 435
- 0
Từ khóa: báo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcbáo cáo sinh học phân tửBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ