0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

Báo cáo hóa học: " A systematic review of mobility instruments and their measurement properties for older acute medical patients" doc

Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... Ward, and W J. Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceeding of ACL-2002, pp. 311-318. A. I. Rosti, N. F. Ayan, B. Xiang, S. Matsoukas, R. Schwartz...
  • 8
  • 546
  • 1
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1 ... tomammalian glutathione peroxidases. A selenocysteine, a tryptophan and a glutamine residue form a catalytictriad in the active site in mammalian GPX4 and areessential for peroxidase activity...
  • 16
  • 483
  • 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... deoxyribonuclease (DNase I, amplification grade;TaKaRa, Kyoto, Japan).Microarray analysis and data mining (Aligentarray) A one-color microarray-based gene expression analysis sys-tem (Agilent Technologies, ... Thisanalysis of microarray data revealed a striking similar-ity of gene clusters among AT-MSC-Hepa, primaryhepatocytes and human liver. This indicates thatAT-MSC-Hepa are similar to human hepatocytes ... 425–438.33 Hatada I, Fukasawa M, Kimura M, Morita S, Ya-mada K, Yoshikawa T, Yamanaka S, Endo C, Saku-rada A, Sato M et al. (2006) Genome-wide profiling of promoter methylation in human. Oncogene...
  • 14
  • 597
  • 0
Báo cáo khoa học: A truncated form of DNA topoisomerase IIb associates with the mtDNA genome in mammalian mitochondria doc

Báo cáo khoa học: A truncated form of DNA topoisomerase IIb associates with the mtDNA genome in mammalian mitochondria doc

... thesupernatant fraction containing soluble mtDNA replicationfactors (fraction II) was recovered and stored at 3 °C.Relaxation and catenation assays for DNAtopisomerase II activityEach relaxation ... agarose-gel assays are shown. Relaxed and supercoiled (sc) forms of the plasmid DNA are as labeled. (A) Time course. Standard agarose-gel, relaxation assays contained 20 ng of fraction VI enzyme, ... at a concentration of about 70 lM.The mt topoisomerase II lacks DNA gyrase activity asindicated by the failure of the enzyme to supercoil 500 ng of a relaxed DNA template in standard assays...
  • 14
  • 428
  • 0
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

... sequences for the mRNA of b-cateninwere 5¢-AAAGCTGATATTGATGGACAG-3¢. The siRNAagainst luciferase mRNA was used as a control siRNA.The target sequence for luciferase mRNA was 5¢-AACGTACGCGGAATACTTCGA-3¢. ... Flight Attendant Medical ResearchInstitute grants 032040 and 072104, and AmericanHeart Association Greater Southeast Affiliate grants0555322B and 0855338E.References1 Aarbiou J, Rabe KF & ... 129,4831–4842.29 Dasgupta C, Sakurai R, Wang Y, Guo P, Ambalava-nan N, Torday JS & Rehan VK (2009) Hyperoxia-induced neonatal rat lung injury involves activation of TGF-{beta} and Wnt signaling, protection...
  • 12
  • 602
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc

... 39th Annual Conference on Association of Computational Linguistics (ACL), 124-131.E. Charniak, K. Knight and K. Yamada. 2003. Syntax-based language models for statistical machine transla-tion. ... use its approximation, a linear com-bination of 5-gram/2-SLM and 2-gram/4-SLM, and for 5-gram/2-SLM or 2-gram/4-SLM, again we cutoff its fractional expected counts that are less than a threshold ... standard MapReduce paradigm (Dean and Ghemawat, 2004): the corpus is first divided and loaded into a number of clients, and n-gram countsare collected at each client, then the n-gram countsmapped and...
  • 10
  • 567
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Task-oriented Evaluation of Syntactic Parsers and Their Representations" potx

... Klein,2007), but also include dependency parsers (Mc-Donald and Pereira, 2006; Nivre and Nilsson, 2005;Sagae and Tsujii, 2007) and deep parsers (Kaplanet al., 2004; Clark and Curran, 2004; Miyao and Tsujii, ... statistical features in a machinelearning classifier (Yakushiji et al., 2005; Katrenko and Adriaans, 2006; Erkan et al., 2007; Sætre et al.,2007). PPI identification is a reasonable task for parser ... extrac-tion from biomedical literature. In EACL 2006.T. Hara, Y. Miyao, and J. Tsujii. 2007. Evaluating im-pact of re-training a lexical disambiguation model ondomain adaptation of an HPSG parser. In...
  • 9
  • 483
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Freely Available Morphological Analyzer, Disambiguator and Context Sensitive Lemmatizer for German" pdf

... wundern, wund Table 3: Word forms with several lemmata. Conclusions In this paper, a freely available integrated tool for German morphological analysis, part -of- speech tagging and context sensitive ... sensitive lemmatiza- tion was introduced. The morphological ana- lyzer is based on the standard Duden grammar and provides wide coverage due to a lexicon of 324,000 word forms and the ability to ... provides about 85% accuracy for the large and 96% accuracy for the small tag set. The lemmatizer uses the output of the tagger to disambiguate word forms with more than one possible lemma. It achieves...
  • 6
  • 287
  • 0
Báo cáo y học:

Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

... 76-year-old man with a coarctation of the aorta. Cardiology 1999, 92:284-286. 8. Bauer M, Alexi-Meskishvili V, Bauer U. Benefits of surgical repair of coarctation of the aorta in patients older ... York: McGraw Hill Professional; 2004:1866. 4. Campbell M. Natural history of coarctation of the aorta. Br Heart J 1970, 32:633-640. 5. Jenkins NP, Ward AR. Coarctation of the aorta: natural history ... Discussion Aortic coarctation is a congenital vascular lesion typically diagnosed in early life, accounting for 5 to 10% of all congenital cardiovascular malformations1 but may go undetected...
  • 2
  • 487
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcbáo cáo y họcNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP