báo cáo hóa học: " The Dutch version of the knee injury and osteoarthritis outcome score: A validation study" pdf

Báo cáo y học: "Spindle Cell Lipoma of the Hypopharynx"

Báo cáo y học: "Spindle Cell Lipoma of the Hypopharynx"

... the under- standing and diagnosis of benign non-epithelial endolaryngeal tumours. In connection with a case of chondroma, one of lipo- ma and one of rhabdomyoma. Acta Otorhinolaryngol Belg 1983; ... feeling of a mass in the throat without dysphagia was the only symptom of large pyriform sinus lipoma. Although the mass may be asymptomatic, it should be surgical...
Ngày tải lên : 25/10/2012, 10:51
  • 3
  • 479
  • 0
Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... proteins, and the (Gal) 5 -TATA lucifer- ase reporter (A) , or the (Gal) 5 -SV40 reporter (B). Luciferase activity was assayed after 48 h, and is presented as the mean + standard devia- tion of duplicate ... intramolecular interactions, allowing access to the AD. As the autoinhibition affected an unrelated AD when this was put in place of the native Meis2d AD, it appears t...
Ngày tải lên : 16/02/2014, 15:20
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: Substrate specificity of the pseudouridine synthase RluD in Escherichia coli doc

Tài liệu Báo cáo khoa học: Substrate specificity of the pseudouridine synthase RluD in Escherichia coli doc

... Pwo polymerase (Roche Diagnostics GmbH, Mannheim, Ger- many) and primers rluD114::cat(pKD3) 5¢ (5¢-GCT ACA ATA GCA CAC TAT ATT AAA CGG CAA AGC CGT AAA ACC CC G TGT AGG CTG GAG CTG CTT CG- 3¢) and rluD114::cat(pKD3) ... rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AAT GTG AAA AGA AAA TCA CGC GTA CCG GAT CGT CTT G AT GGG AAT TAG CCA TGG TCC-3¢) (comple- mentary regions to the rluD-flanking region...
Ngày tải lên : 18/02/2014, 16:20
  • 8
  • 596
  • 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

... molecule, and individual mutations drastically reduced the activity. Because Ala lacks the character- istic side chains of Glu and Arg, the mutant recep- tors are devoid of the functional groups at the particular ... noteworthy that the inverse agonist activ- ity of 4-OHT and the inverse antagonist activity of BPA are observed for both (275Ala)-ERRc and (316Ala)-...
Ngày tải lên : 18/02/2014, 16:20
  • 12
  • 583
  • 0
Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt

Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt

... GGAATTCCATATGAGTGATAAAAACGCTAACGTC (R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC 11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC 12 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) ... GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG (R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC newpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAGCTTATGAAACACCACCACCACCACCACCA newpe...
Ngày tải lên : 19/02/2014, 00:20
  • 10
  • 510
  • 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

... evaluate the contribution of K88 and K13 to protein stabilization in the reaction with sul- fate. The far-UV and Soret CD spectra of the two mutants (not shown) reveal that the two variants and the ... observed may indicate that the variants undergo very fast optical (and thus structural) changes within the dead time of the stopped-flow apparatus. In the case...
Ngày tải lên : 19/02/2014, 05:20
  • 11
  • 487
  • 0
Tài liệu Báo cáo khoa học: Co-operative effect of the isoforms of type III antifreeze protein expressed in Notched-fin eelpout, Zoarces elongatus Kner ppt

Tài liệu Báo cáo khoa học: Co-operative effect of the isoforms of type III antifreeze protein expressed in Notched-fin eelpout, Zoarces elongatus Kner ppt

... crystal in the final state. This hypothesis is comparable to that of Bur- cham et al. [31]. They assumed that stabilization of the antifreeze action of small (weak) species of AFGP (AFGP6-8) by large ... cDNA consisting of 500 bp purified from the cDNA library using the templates of Ex-Taq DNA polymerase (TaKaRa), oligo-dT linker primer (5¢-GAGAGAACTAGTCTCGAGTTT-3¢), and...
Ngày tải lên : 19/02/2014, 16:20
  • 11
  • 696
  • 0
Tài liệu Báo cáo khoa học: "On Learning Subtypes of the Part-Whole Relation: Do Not Mix your Seeds" pdf

Tài liệu Báo cáo khoa học: "On Learning Subtypes of the Part-Whole Relation: Do Not Mix your Seeds" pdf

... Keet and Artale, 2008). The taxonomy of Keet and Ar- tale (2008), for instance, distinguishes part-whole relations based on their transitivity, and on the semantic classes of entities they sub-categorize. Part-whole ... (member -of, sub-quantity -of, contained-in, structural part -of and located-in), and for the general set composed of all types. 4.1 Precision of Ext...
Ngày tải lên : 20/02/2014, 04:20
  • 9
  • 622
  • 0
Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

... epitope. The extracellular part of the epithelial glycoprotein MUC-1 consists of tandem repeats of 20 amino acids (PDTRPAPGSTAPPAHGVTSA, where the start of the tandem repeat peptide sequence varies. ... e crystalcellthathaveadistanceof 4A ˚ or less to the ligand. The C-terminal part of the pe ptide (RPAP) has clo se contacts to the n ext protein in the crystal cel...
Ngày tải lên : 21/02/2014, 15:20
  • 12
  • 717
  • 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

... obtained for the glutaminase reaction in the presence of 0.1 m M each of UTP and ATP-cS (data not shown). Apparently, the value of K a , k cat,1 and k cat,2 were similar regardless of the active ... 4-phosphorylated UTP intermediate in a mechanism as that of Scheme 1A. From Fig. 4 and Table 2 it can be seen that the effect of saturating the active site with...
Ngày tải lên : 21/02/2014, 15:20
  • 8
  • 698
  • 0

Xem thêm

Từ khóa: