báo cáo hóa học: " Development and psychometric validation of a self-administered questionnaire assessing the acceptance of influenza vaccination: the Vaccinees'''''''' Perception of Injection (VAPI©) questionnaire" docx
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... area.This led to 14 possible combinations: (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha)B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, ... end. The following fragments were assignable (the assigned a- Rha being bold):B A B A, B A B– A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A, A A B (Table 1).In summary, ... by the a- Fuc3NAc(1fi2) a- Rha disaccharide. The conclusion is that b-Rha could be assigned in the following combinations (the assigned b-Rha are in bold): A- B A A/ B, A- B A A/ B, A- B A AandA–B A A. (Table...
- 9
- 454
- 0
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"
... VARA data were used only to capture the DAS28, the CDAI and other clinical characteristics measured at the baseline and outcome VARA visits; all other data used for the analysis were from the ... Authors’ contributions All authors made substantial contributions to conception and design, and to the analysis and interpretation of the data. TRM and GWC handled acquisition of data. All ... pharmacy data. While clinical disease activity measures remain the gold standard for assessing effectiveness in RA, the many large administrative data sources in the U.S. and internationally are...
- 29
- 581
- 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... nonterminal labels of the treebank grammar. For example, our grammar main- tains a fairly large number of semantic classes of singular nouns, and it is natural to stipulate that each of them is label-consistent ... is that it allows the grammar- ian to obtain quickly a very large 3 set of sentences that 2Actually there are 18 x 3 = 54 labels, as each label L has vari- ants LA: for a first conjunct, and ... being the feature bundle all of whose features are variable, and with a decreasing number of variable features occuring as a branch is traced from root to leaf. To find the mnemonic .A4 (A) assigned...
- 8
- 562
- 0
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... Table 1 shows a four-category data configu- 247 Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat ... a reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging that is applicable to any ... revision of the cod- ing manual results in as much as a 16 point im- provement in pairwise Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences...
- 8
- 354
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) ... Billerica, MA, USA).Initial characterization of the protein The purity and molecular mass of the protein were checkedby 12% SDS ⁄ PAGE and MALDI-TOF MS. Gel-permeationchromatography with 200 lLofa1mgÆmL)1protein ... S, Khachatr-yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotogamaritima stationary phase survival protein SurE: a novel acid phosphatase. Structure...
- 10
- 553
- 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel-opment (blastula, gastrula, trochophore larvae, D lar-vae, 7 and ... to the amino terminal end and C2defines the domain closest to the cell membrane. A comparison of the inferred amino acid sequence of the C1 and C2 domains reveals that only the approximatespacing ... insynapse regulation and ⁄ or maintenance [15,16].As part of an ongoing project to understand the role of the TGF-b superfamily ligands, their receptors and signal transduction pathways in the...
- 17
- 508
- 0
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... includ-ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran-scription (JAK-STAT) pathway, to promote prolifera-tion, survival and transformation ... in the Cook laboratory is funded by the Asso-ciation for International Cancer Research, Astra-Zeneca, the Babraham Institute, the Biotechnology and Biological Sciences Research Council and CancerResearch ... downstream survival signalling pathways and a consequent increase in the expres-sion of BIM. Inactivation of the ERK1 ⁄ 2 pathway seems to be particularly important for upregulation of the most abundant...
- 13
- 453
- 0
Báo cáo khoa học: "Aspect and Discourse Structure: Is a Neutral Viewpoint Required?*" pot
... two-level theory gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying ... the initial and finishing points of a situ- ation are indicated by I and F respectively. The duration of the situation can be drawn in two differ- ent ways: as an unstructured ( ) and a structured ... The defendant was driving home. At the Lustnauer tower he had a serious accident and had to be admitted to the hospital. In (la) the VP fuhr nach Hause refers to a com- pleted event and therefore...
- 3
- 254
- 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... these bacteria are the aetiological factor of enteric diseases but they are alsoassociated with extraintestinal disorders, among which the most significant are neonatal meningitis and brain abscesses[1,2]. ... above for sugar analysis, and the partially methylated monosaccharides derived were conver-ted into the alditol acetates and analysed by GLC-MS.Smith degradationOPS-I, OPS-II and the O-deacetylated ... the serological classification of Citrobacter strains and tosubstantiate multiple cross-reactions between Citrobacter and other genera of the family Enterobacteriaceae,suchasHafnia, Escherichia, Klebsiella...
- 7
- 478
- 0
Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx
... addition and permutation of stems and affixes. After making sure that the re-quired affixes and stems were included in the lexicon of the grammar, we ran a comparison of exact pars-ing with the ... instance of stacking of depth 3 was observed. So, the range of phenom-ena for which the approximation is inexact is of lit-tle practical relevance. For a full evaluation of the coverage and exactness ... stored as a unit, but the remainder of the analysis is rule-based. With this depth of recursion (and a realistic morphological grammar),we get an unmanagable explosion of the number of states in the...
- 8
- 353
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật