báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC ... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt
... reductaseSREBP-2NADPHPyruvateAcetyl-CoACitrateacetyl-CoAOxaloacetateOxaloacetateACLACCHMG-CoAHMG-CoA synthaseCitrateMalonyl-CoAPalmitateMalateMitochondriaFASACCSCDFatty acid ... Endo Y,Ishikawa M, Matsuzaka T, Nakagawa Y, Kumadaki S,Yahagi N et al. (2006) Granuphilin is activated bySREBP-1c and involved in impaired insulin secretion in diabetic mice. Cell Metab 4, 143–154.32 ... SREBP-1c, indicating a relationshipbetween lipid metabolism and the parasympatheticresponse that may play a role in arrhythmogenesis.Regulation of sulfonylurea channels and other potas-sium channels...
- 6
- 574
- 1
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc
... from the evolution of thisfamily.Evolution based on domain reusing might explain the abundance of certain protein domains and is a way of easily increasing the number of TFs, as appears tohave ... T, Maruy-ama M, Saito M, Yamada M, Takahashi H & Tsuji S(1999) A neurological disease caused by an expandedCAG trinucleotide repeat in the TATA-binding proteingene: a new polyglutamine ... Functionality can belinked to structure, as is the case of DNA-binding and Zn finger domains, or the fork-head DNA-bindingdomains in the E2F ⁄ pRB pathway [56]. Another exam-ple is the enzymatic activity...
- 12
- 511
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... amount of radioactivity incorporated into the nucleic acids was measuredafter TCA precipitation and plotted against the incubation time in minutes.T. Astier-Gin et al. Binding and replication of ... a minus-strandRNA that serves as a template for the synthesis of new plus-strand RNA molecules. Initiation of RNAsynthesis at the 3¢-end of the plus- and minus-strandRNA most probably involves ... the size of the template was almost as abun-dant as the product the same size as the template. In Table 1. RNA synthesis obtained with mutants of (–)IRES RNAwithout or with heparin. Determination...
- 15
- 597
- 0
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx
... 2002Effect of EDTA as a function of the concentration in free manganese ionsTheconcentrationoffreemanganeseionswascalculatedateach EDTA concentration using an apparent EDTAstability constant K1 of ... and partial characterization of CDP-diacylglycerol: inositol transferase and myo-inositol exchange reactions. Quadrennial Joint Meetings of the American Society of Plant Biologists and the CanadianSociety ... membranes as a source of enzyme. The transformation of E. coli, a host naturally devoid of PtdIns synthase with a single cDNA ensured that the recombinant protein was the only candidate for the activities...
- 6
- 551
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... temperature in SOCmedium and then plated on Luria–Bertani agar platescontaining kanamycin. Kanamycin resistant (KmR)trans-formants were selected and colony-purified on agar platesincubated ... toestimate the ratio between the amounts of UP12 and the total amount of protein in the extracts, a series of samplescontaining determined amounts of the purified UP12 wereseparated by SDS/PAGE along ... deoxyoligonucleotide(5¢-CGCGGATCCATGTATAAGACAATCATTATGC-3¢)containing a BamHI site (underlined nucleotides) and a 3¢deoxyoligonucleotide harboring a HindIII site (5¢-CCCAAGCTTTTAACGCACAACCAGCACC-3¢) as primers with E. coli genomic DNA as a template and...
- 9
- 548
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads. The size and position of molecular weight stan-dards are indicated on the left. (B) The catalytic activity of ... 155Diptera, Coleoptera, and Lepidoptera, there are inter-esting variations in how the pathways are initiated byrecognition of microbial patterns and by microbialproteinases. Further biochemical and ... later, hemolymph was collected, and fat body RNA samples were prepared from each insect. (A) Antimicrobial activity of plasma assayed against E. coli, and identification of antimicrobial plasma...
- 15
- 540
- 0
Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt
... translation showed that they hold the characteristic features of all known papain-class cysteine proteinases, and a phylogenetic analysis revealed the existence of several papain and chymopapain ... VXH-D, and from that of V. stipulata: VS -A and VS-B. The amino acid sequence of all six cDNA-sequences wasdeduced in silico and analyzed. A detailed comparisonwas made with the available sequence ... its latex (papain and chymopapain). After the divergence of these genera, their genes haveevolved into different paralogues. Within the genusVasconcellea, the evolutionary pathway of cysteineproteinases...
- 12
- 525
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... superfamily, such as the absence of the exon encoding the KPI domain and the lack of a secondheparin-binding domain [3,4,13,26].Comparative analysis of the Xenopus and mammalianAPLP2 proteinsComparing ... duplication in the preAPLP family mayhave resulted in the appearance of the APLP1 and APLP2gene families. The fact that both mammals and Xenopuscontain APP and APLP2 proteins suggests that the ... proteinscontaining a signal peptide, a large amino-terminal luminal/extracellular part, a transmembrane domain and a shortcytoplasmic tail. The luminal portions of all superfamilymembers contain conserved...
- 7
- 405
- 0
Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt
... It appeared that the amino t erminus of mutant huntingtin containing an expan-ded polyglutamine tract caused the steady-state CB1mRNA levels in the lateral striatum to decrease between 3 and ... neuro-degeneration of a subpopulation of cells in the basal ganglia. In addition, a reduction in the level of normal huntingtinmay also be detrimental to the survival and function of neurons [4,5].One of ... *TA*******T****T *A* ****************T*****C*****G****G**CC**C***GC**C****G***GA*AA******************* MGGGACCACGCTTCATAAATGGGACTGGAGA BOX +1 +57 GAGCGAGAGCAGGCCAGAGACAGCGCGCGAGCTGAGGGAGAGGCAGGGAC CTCAAGCAGGGCGCGGCGACGGH...
- 12
- 504
- 0
Từ khóa: reliability and validity of measurementbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo giáo dục thể chất trường tiểu họcthe definition of reliability and validitytrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdfbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caolam the nao de tom tat bao cáo khoa hocNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP