Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

Báo cáo sinh học: " The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting" doc

... 9:75 http://www.translational-medicine.com/content/9/1/75 Page 3 of 8 REVIEW Open Access The role of mutational analysis of KIT and PDGFRA in gastrointestinal stromal tumors in a clinical setting Alessandra Maleddu 1* , ... 10555]. doi:10.1186/1479-5876-9-75 Cite this article as: Maleddu et al.: The role of mutational analysis of KIT and PDGF...
Ngày tải lên : 18/06/2014, 19:20
  • 8
  • 517
  • 0
báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc

báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc

... surround- ing dual practice are about medical practice generally rather than dual practice as an isolated activity. An important aspect of regulation is its potential role in addressing the type of ... and increasing competition in this market and undermining individuals' income earning ability. Another manifestation of these pressures in this market was the 'e...
Ngày tải lên : 18/06/2014, 17:20
  • 8
  • 496
  • 0
báo cáo sinh học:" The role of leadership in HRH development in challenging public health settings" potx

báo cáo sinh học:" The role of leadership in HRH development in challenging public health settings" potx

... Direc- torate of Human Resources put in place a national regis- tration system and created a database that details the training and background of 24 500 health workers. A semi-autonomous board was established ... Noormal's approach to achieving the gains made by the Directorate of Human Resources has been character- ized by a process of reaching consensus and...
Ngày tải lên : 18/06/2014, 17:20
  • 7
  • 571
  • 0
báo cáo sinh học:" The role of pharmacists in developing countries: the current scenario in Pakistan" potx

báo cáo sinh học:" The role of pharmacists in developing countries: the current scenario in Pakistan" potx

... Masood 1 and Asrul Akmal Shafie 1 Address: 1 Social and Administrative Pharmacy, School of Pharmaceutical Sciences, Universiti Sains Malaysia, Penang, Malaysia and 2 Department of Pharmacy, University ... pharmacies because of the isola- tion and lack of recognition of pharmacists as health care professionals. The lack of trained personnel and the resulting lac...
Ngày tải lên : 18/06/2014, 17:20
  • 6
  • 413
  • 0
báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf

báo cáo sinh học:" The role of nurses and midwives in polio eradication and measles control activities: a survey in Sudan and Zambia" pdf

... monitoring and evaluation) and the same proportion was involved in AFP surveillance. On the other hand, in Zambia, nurses and midwives were involved in the full range of functions for SIAs and AFP ... conceptualized the project and wrote the study pro- posal, designed the questionnaires and initiated and par- ticipated in discussions, data analysis and...
Ngày tải lên : 18/06/2014, 17:20
  • 8
  • 628
  • 0
Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

... STAT1, STAT3, and STAT5 pathways. In clinical trials, IL-21 has shown promising clinical benefits among patients with melanoma and renal can- cer. IL-21 may find additional clinical applications ... first line melanoma treatment has been completed and is awaiting data analysis. CTLA-4 blockade has also been tested in phase II clinical trials of castrate-resistant prostate...
Ngày tải lên : 18/06/2014, 19:20
  • 15
  • 602
  • 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC HJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG ASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCC...
Ngày tải lên : 21/02/2014, 01:21
  • 10
  • 672
  • 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

... 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢. ... details about the role of different resi- dues of the aglycone-binding site in the stabilization of ES à and the interdependence between the...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 731
  • 0
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx

... Renata Piccoli, for critical reading the manuscript and helpful suggestions; and to Dr Valeria Cafaro, Aurora Bracale, Antonella Antignani and Sonia Di Gaetano for preparing some of the RNase variants ... through rotation of the RNase around its major axis (rotation angle ‘r’) and variation of the inclination (inclination angle ‘i’) with respect to the plane of the...
Ngày tải lên : 19/02/2014, 06:20
  • 11
  • 643
  • 0
Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

Tài liệu Báo cáo khoa học: The role of antioxidants in the cytotoxicity of chemotherapeutic drugs pptx

... osmoregulation and sporulation. Isola- tion and characterization of yeast mutants blocked at various sta- ges of transport pathways are an invaluable method for unravelling the molecular details of vacuolar ... syndrome and adipocytokines Y. Matzuzawa Department of Internal Medicine and Molecular Science, Graduate School of Medicine Osaka University, Osaka, Japan Visceral...
Ngày tải lên : 19/02/2014, 07:20
  • 7
  • 749
  • 0

Xem thêm

Từ khóa: