Báo cáo sinh học: " Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model Linda Petrone1, Maria G Ammendolia2, Armando" ppt
Báo cáo sinh học: " Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model Linda Petrone1, Maria G Ammendolia2, Armando" ppt
... Access Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model Linda Petrone1, Maria G Ammendolia2, ... al.: Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model. Journalof Translational Medicine ... (IgG1, Ig G2 b, IgG2c and IgG3).Antigen-antibody complexes were detected using the fol-lowing HRP-secondary antibodies (Sigma-Aldrich): rabbitanti-mouse IgG (H+L), goat anti-mouse IgM (μ-chain),goat...
- 9
- 276
- 0
báo cáo hóa học:" Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model" doc
... al.: Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model. Journalof Translational Medicine ... (IgG1, Ig G2 b, IgG2c and IgG3).Antigen-antibody complexes were detected using the fol-lowing HRP-secondary antibodies (Sigma-Aldrich): rabbitanti-mouse IgG (H+L), goat anti-mouse IgM (μ-chain),goat ... dialysis in Tris buffer and then analy sed by western blotting in reducing and non-reducing SDS-PAGE. In the reducing gel, the E7 proteinappears in monomeric form (Figure 1, lane 1). In non-reducing...
- 9
- 307
- 0
Báo cáo sinh học: " In vivo transcriptional targeting into the retinal vasculature using recombinant baculovirus carrying the human flt-1 promoter" potx
... from retinas obtained from mock-injected animals and animals injected with BacFLT-GFP. A movie showing the rotating vessels obtained from mock-injected retinas and transduced with recombinant ... penicillin (100 U/ml), streptomycin(100 U/ml) and 0.1% (vol/vol) pluronic F-68 (Invitrogen,Grand Island, NY). Mammalian cell lines includinghuman (HepG2, HEK-293) and the rat cell lines (C6, RIN-m5F) ... this date in vivo transcriptional genetargeting by recombinant baculovirus. In this study, we produced a recombinant baculovirus(BacFLT-GFP) containing the human flt-1 promoter driv-ing the expression...
- 12
- 271
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... template-Checking of specificity of RT-PCRs for the wt and the recombinant S RNA segmentsFigure 1Checking of specificity of RT-PCRs for the wt and the recombinant S RNA segments. Lines 1–3: products ... recombination "hot-spot" in the plus- and minus- sense S RNA of TULV.GGAAAUG GCCAAGU G- CA-U G- CA-UU-A G GU-A G: UCA-UU-A337 381(+) senseU :G U-AC UC -G U-A C -G U-AC -G U-AA-UC ... RECF738(5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Hairpin-like structures predicted for the recombination "hot-spot" in the plus- and minus- sense S RNA of TULVFigure 3Hairpin-like...
- 5
- 483
- 0
báo cáo sinh học:" Final call for papers: "Towards a scaling-up of training and education for health workers" potx
... Additionalcontributing factors include: inadequate compensation and working conditions, the deteriorating health of theworkforce in many developing countries, urban/rural and workforce imbalance, and migration ... existing efforts to train health work-ers using innovative methods, including distance learning and various forms of information technology? How willtraining by protocol differ from, and complement, ... responsive to exiting needs• task-shifting/role substitution• competency-based education and trainingExamples of questions that could be considered are:• What ongoing efforts to increase graduate...
- 2
- 370
- 0
báo cáo sinh học:" Retention of health workers in Malawi: perspectives of health workers and district management" docx
... bonus.The in- service training, which represents training on spe-cific topics to enhance performance, is organized withinthe districts. Training needs are identified by programmemanagers and proposals ... for in- service training in the ministry by the training coordinators. They believedthat favouritism seemed also to exist with regard to bothcontinuous education and in- service training. An enrollednurse ... issues surrounding continuouseducation and in- service training and performance man-agement: supervision/staff appraisal/job description;working conditions; deployment/transfers; and retentionfactors....
- 9
- 396
- 1
báo cáo sinh học:" Scaling up proven public health interventions through a locally owned and sustained leadership development programme in rural Upper Egypt" ppt
... leading and managingpractices: how to scan their environment and focus on apriority challenge; align and mobilize their teams and their stakeholders; and inspire each other. They learnedto manage ... two-dayworkshops, learning leadership and management prac-tices (see Figure 1) and applying simple planning and performance improvement tools to identify and ad dresstheir challenges.The purpose ... technical and other resources to lead the original LDP in Egypt. JBM brought the applied transformational leadership models and practices to Egypt and worked with MM and a team of Egyptian consultantsto...
- 6
- 368
- 0
báo cáo sinh học:" A model linking clinical workforce skill mix planning to health and health care dynamics" pot
... sensitivity analy-sis can be performed.The advantages of dynamic modelling are that it canprovide leadership, co-ordination and inform planning in a real world context.Our discussion and modelling ... 'Facilities, Technologies and Resources', which encompasses all facilities and technol-ogies, and also a financial subsystem 'Funds and Support',containing funding and the political ... repro-duction in any medium, provided the original work is properly cited.MethodologyA model linking clinical workforce skill mix planning to health and health care dynamicsKeith Masnick*1 and Geoff...
- 10
- 398
- 0
báo cáo sinh học:" Doubling the number of health graduates in Zambia: estimating feasibility and costs" pdf
... process of designing, executing and distributingthe analysis - including target definition and finalapproval by every training institution - was highlydependent on input from the many stakeholders ... teach-ing staff will need to roughly double. The government isworking towards reaching this faculty staffing goalthrough expanding the training pipeline of faculty,Table 2 Additional recurring ... school’smanagement and training program heads. An Excel-based calculating tool converted the indivi-dual school scale-up needs into one-time and additionalannual recurring costs. Standard cost...
- 9
- 609
- 0
báo cáo sinh học:" The health workforce crisis in Bangladesh: shortage, inappropriate skill-mix and inequitable distribution" potx
... repre-sentative data on HRH in the formal and informal sectors in Ba ngladesh. This is essential for developing an HRHpolicy and plan and its implementation to meet the chan-ging health needs of the ... no competing interests in conducting the research and writing the manuscript.Received: 11 February 2010 Accepted: 22 January 2011Published: 22 January 2011References1. Anand S, Barnighausen ... workers and vaccination coverage in developing countries: an econometric analysis. Lancet 2007,369:1277-1285.2. JLI (Joint Learning Initiative): Human Resources for Health: Overcomingthe crisis....
- 7
- 373
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ