báo cáo hóa học: " Quality of life in caregivers of patients with schizophrenia: A literature review" ppt
báo cáo hóa học: " Quality of life in caregivers of patients with schizophrenia: A literature review" ppt
... CentralPage 1 of 5(page number not for citation purposes)Health and Quality of Life OutcomesOpen AccessReview Quality of life in caregivers of patients with schizophrenia: A literature ... mem-bers. In addition, some close relatives might go awayavoiding having to take care of the patient [5,16,21,37,39-42].Damage in caregiver social life and a lack of social supporthas lead to caregivers ... variables are related to QOL damage in caregivers of patients with schizophrenia?Main variable was emotional burden on caregivers as a consequence of their role, lack of social and working sup-port,...
- 5
- 506
- 1
báo cáo hóa học:" GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment" pptx
... 851 patients from central China were also ana-lyzed for mutations in Exon1 and flanking introns byPCR/sequencing. The PCR primers used are forwardprimer:5'CTCATGGGGGCTCAAAGGAACTAGGAGATCGG3'and ... detected in theminorities of Xinjiang, and accounted for almost half of the GJB2 mutant alleles in minorities of Xinjiang (9c.35delG/19 total mutant alleles). The finding of thec.35delG mutation in ... preliminary data of molecular epidemiol-ogy of hearing impairment in China [28,39-41], Li hascombined allele-specific PCR and universal array(ASPUA) methodologies for the detection of mutationscausing...
- 12
- 507
- 0
báo cáo hóa học: " Quality of life in South East Asian patients who consult for dyspepsia: Validation of the short form Nepean Dyspepsia Index" docx
... necessi-tate local cultural adaptation, translation and validation of established HRQoL instruments. In a representativeSouth East Asian population with a significant prevalence of dyspepsia, we have ... Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia, 2Department of Rheumatology and Immunology, Singapore General Hospital, Singapore, 3Department of Pharmacy, National University ... Motility Interest Group, Mayo Clinic College of Medicine, for letting us translate the SF-NDI into Malay; & Mrs Satwant Kaur and Mrs Maznah Mohammed, Fac-ulty of Linguistics and Malay Languages,...
- 9
- 447
- 0
báo cáo hóa học: "Quality of life in Brazilian obese adolescents: effects of a long-term multidisciplinary lifestyle therapy" pdf
... maralofrano@gmail.com; Hanna Karen Moreira Antunes - hannakaren@psicobio.epm.br; Wagner Luiz do Prado - wagner.prado@upe.br; Aline de Piano - aline.depiano@gmail.com; Danielle Arisa Caranti - danielle@caranti.com.br; ... patients with and withoutobesity. Health Qual Life Outcomes 2008, 6:11.11. Hassan MK, Joshi AV, Madhavan SS, Amonkar MM: Obesity andhealth-related quality of life: A cross-sectional analysis of ... citation purposes)Health and Quality of Life OutcomesOpen AccessResearch Quality of life in Brazilian obese adolescents: effects of a long-term multidisciplinary lifestyle therapyMara Cristina...
- 8
- 428
- 0
báo cáo hóa học: " Quality of life data as prognostic indicators of survival in cancer patients: an overview of the literature from 1982 to 2008" pot
... quality of life dataor some quality of life measures and the survival duration of cancer patients. Pre-treatment(baseline) quality of life data appeared to provide the most reliable information ... The findings indicated that changes in the quality of life index, measured by a series of LinearAnalog Self Assessment (LASA) scales for physical well-being, mood, pain and appetite, were independent ... evaluated with caution. A recent meta-analysis of therelationship between baseline quality of life data from theEORTC clinical trials and survival indicated that physicalfunctioning was a...
- 21
- 717
- 1
báo cáo hóa học: " Quality of care and health-related quality of life of climacteric stage women cared for in family medicine clinics in Mexico" pot
... collaboration in designing and validating the quality of care indicators.Table 5 Relationship between health-related quality of life †and quality of careCoefficient Confidence intervals at ... article as: Doubova Dubova et al .: Quality of care and health-related quality of life of climacteric stage women cared for in familymedicine clinics in Mexico. Health and Quality of Life Outcomes ... 12RESEARC H Open Access Quality of care and health-related quality of life of climacteric stage women cared for in familymedicine clinics in MexicoSvetlana Vladislavovna Doubova Dubova1*,...
- 12
- 451
- 0
báo cáo hóa học: " Quality of life in chemical warfare survivors with ophthalmologic injuries: the first results form Iran Chemical Warfare Victims Health Assessment Study" potx
... collected data and all partici-pants were interviewed in their home.Data for a general Iranian population derived from a pop-ulation-based study of a random sample of the 4163 indi-viduals aged ... mustard gas is an alkylating agentthat has serious, toxic effects on skin, eyes and respiratorysystem [2].War has a far-reaching impact on the health and wellbeing of the soldiers, war veterans, ... thetopic.MethodsDesign and data collectionAll injured survivors (both civilians and veterans) of theIran-Iraq war are given a severity index (disability rate) in the Veterans and Martyrs Affair Foundation (VMAF)...
- 8
- 383
- 0
báo cáo hóa học: " Correlations among improvements in urgency urinary incontinence, health-related quality of life, and perception of bladder-related problems in incontinent subjects with overactive bladder treated with tolterodine or placebo" docx
... indicatesimprovement.Statistical analysisMedian percentage changes in UUI episodes per weekwere analyzed using a rank analysis of covariance(ANCOVA) with baseline value as a covariate; meanchanges ... was also demonstratedthat the prevalence of OAB increases with advancing age,occurring in 20% of subjects who are ≥ 60 years of age.Antimuscarinics, such as tolterodine, are first-line treat-ments ... the drafting andrevising of the manuscript. PvK was involved in collectingthe data. JTW conducted the data analysis. All authorshave read and approved the final manuscript.Mean change in KHQ...
- 6
- 466
- 0
Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf
... Alamgir AH, Anis AH, Fitzgerald MJ, Marra CA:Evaluating health-related quality- of- life studies in paediatricpopulations: some conceptual, methodological and develop-mental considerations and ... PICU of theEmma Children's Hospital/Academic Medical CenterAmsterdam is a tertiary PICU with 14 beds admitting patients from the greater Amsterdam area. Medical, surgi-cal and trauma patients ... qualitative analysis of content. J Adolesc Health 2004,34:37-45.11. Varni JW, Burwinkle TM, Lane MM: Health-related quality of life measurement in pediatric clinical practice: an appraisal andprecept...
- 9
- 440
- 0
báo cáo hóa học: " Quality of life of Australian chronically-ill adults: patient and practice characteristics matter" doc
... General Practice, University of Adelaide, Adelaide, South Australia, Australia and 3Faculty of Health Sciences, University of Adelaide, Adelaide, South Australia, AustraliaEmail: Upali W Jayasinghe* ... author AbstractBackground: To study health-related quality of life (HRQOL) in a large sample of Australianchronically-ill patients and investigate the impact of characteristics of patients and ... [http://www.aihw.gov.au/publications/gep/gpaa03-04/gpaa03-04.pdf]. Canberra: Australian Institute of Healthand Welfare4. Commonwealth Department of Health and Aged Care (CDoHaA):Enhanced primary care...
- 11
- 461
- 1
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ