0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

báo cáo hóa học:

báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

... CentralPage 1 of 9(page number not for citation purposes)Health and Quality of Life OutcomesOpen AccessResearch Dental pain, oral impacts and perceived need for dental treatment in Tanzanian ... untreated dental caries, oral impacts ondaily performances and perceived need for dental care. Dental pain and reported oral problems variedsystematically with OIDP across the eight impacts ... dental pain and dental problems. Table showing the oral impacts on daily performances by socio-demographics, dental caries, den-tal pain and dental problems. In this table a Adjusted for age,...
  • 9
  • 442
  • 0
báo cáo hóa học:

báo cáo hóa học:" Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" pptx

... dental pain and dental problems. Table showing the oral impacts on daily performances by socio-demographics, dental caries, den-tal pain and dental problems. In this table a Adjusted for age, ... be a reliable and valid instrument when applied to children in numer-ous countries, such as Thailand, France, UK and Tanzania[5-8].Untreated dental caries might lead to dental pain and impact ... primary school in Kilwa dis-trict, Tanzania, detailed the association of clinical- and self-reported oral health indicators with OIDP and exam-ined which oral impacts on daily activities affected...
  • 9
  • 383
  • 0
báo cáo hóa học:

báo cáo hóa học: "Effect of step-synchronized vibration stimulation of soles on gait in Parkinson''''s disease: a pilot study" doc

... caused by a dopamine defi-ciency in the basal ganglia that results in characteristicmotor abnormalities including postural instability and gait impairment. Short shuffling steps, slow walkingspeed, ... walkingspeed, and increased stride variability characterize abnor-mal gait in PD. Although PD is primarily a motor disease,accumulating evidence suggests that abnormal proprio-ception and kinesthesia ... studies showed that stim-ulation of the metacarpal joints activated ipsilateral sen-sory cortical areas and contralateral basal ganglia [32].Results of this study, however, may be not applied to...
  • 7
  • 497
  • 0
báo cáo hóa học:

báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

... sequenceswere as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT;CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C,AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG-Journal of Translational Medicine 2009, 7:43 http://www.translational-medicine.com/content/7/1/43Page ... ACGCCGTCCTTT-GAATAACAA; CHK2-B, AGGACTGTCTTATAAAGATTA;CHK2-C, CAGGATGGATTTGCCAATCTT; and CHK2-D,CTCCGTGGTTTGAACACGAAA. The sequences used in HT-RNAi screening were the A and B sequences for bothCHK1 and CHK2.Synthetic ... screening was per-formed by IMG and MCH and analyzed by SA, JAK and AC. Functional validation of siRNA sensitization and drugsynergy was performed by IMG. KMB, GDB and SA per-formed the validation...
  • 12
  • 348
  • 0
báo cáo hóa học:

báo cáo hóa học: " Health-related quality of life of patients following selected types of lumbar spinal surgery: A pilot study" ppt

... healing.Symptoms: pain and moodThe primary complaints of patients undergoing lumbarspinal surgery are back pain and radicular pain accompa-nied by leg weakness. The goal of spinal surgery is to ... reliabilities may be low due to a change in thepatients' health after surgery as well as a three-monthperiod between test administrations.Data analysisData was entered into the statistical analysis ... status in this study. The Numeric Pain Rating Scale(NPRS) was used to measure degree of pain on a scale of0 to 10 with 0 being no pain and 10 being extreme pain.Pain decreased from a mean...
  • 11
  • 332
  • 0
báo cáo hóa học:

báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot

... study, analyzed and interpreted the data and drafted the manuscript. RD and MBH contributed to the design and interpretation ofthe analysis. All authors read and critically revised and approved ... response to individual items comprising that subscale;the subscales are then standardized using a z-score trans-formation and aggregated to estimate the aggregatedphysical and mental summary scores. ... comprising eightsubscales – physical functioning, role functioning (physi-cal and emotional), bodily pain, general health, vitality,social functioning, and mental health. Using standardmethods...
  • 7
  • 366
  • 1
Báo cáo hóa học:

Báo cáo hóa học: "The toxicity of cadmium and resulting hazards for human health" ppt

... hyperkeratosis and acanthosis with occasionalulcerative change, and an increase of the mitotic index ofthe skin cells. Also cadmium concentration in blood, liver and kidney increased, thus indicating ... μgcadmium; 95% of this taken up with food and drinks. Anaverage smoker has an additional intake of 30 μg per day[4]. Several factors can increase this amount, such as lowintakes of vitamin ... human gastrointestinal is approx-imately 5% of an ingested amount of cadmium, depend-ing on the exact dose and nutritional composition [3]. Anaverage German citizen has a daily intake of 30–35...
  • 6
  • 736
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx

... AGGCCTTCCCGAGAAAGTGCTTAGCCTTGTTGATGATCCAAGGAACCACATAGAGAACCAAGACGAGTGCKIAA0220 Hs.110613 70 1121 416 82.4 60.0 CS TGGAACCATCATCACCCGAACCCAAGAGGCGGAGGGTCGGTGACGTGGAACCGTCACGCAAACCCAAGAGCLU Hs.75106 ... CS GTAGCTGCCTGCATAGGAGCCTCGCTTCCGATTATTCCCTTCCCAATATTATTCATCCAGACTTAGCCACKARS Hs.3100 70 1997 142 73.6 38.6 CS GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAAATAATAATTGCAAGTTGTAAAMP Hs.83347 ... 44.3 CS TATCTTCGGAAGAACCCCAATTATGATCTCTAAGTGACCACCAGGGGCTCTGAACTGTAGCTGATGTTATPSMB3 Hs.82793 70 692 42 79.4 52.8 CS ATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGACTAACCCTGTTCCCAGAGCCT CFL1...
  • 15
  • 426
  • 0
báo cáo hóa học:

báo cáo hóa học:"Special theme on HIV and disability - time for closer bonds" pdf

... dismay-ing lack of adequate efforts in this area, some positivedevelopments have been made. As an example, at the lat-est International AIDS Conference, held in Mexico City in August 2008, several sessions ... PubMed and archived on PubMed Central yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralJournal of the International AIDS ... http://www.jiasociety.org/content/12/1/26Page 2 of 2(page number not for citation purposes)ity and equal opportunity, are among the guiding princi-ples of this convention [2].Research on HIV and disability...
  • 2
  • 266
  • 0
báo cáo hóa học:

báo cáo hóa học:" Response shift, recall bias and their effect on measuring change in health-related quality of life amongst older hospital patients" pdf

... review, appraisal and editing. Bothauthors read and approved the final manuscript.Author Details1Centre for Functioning, Disability and Health Research, Queensland Health, Buranda Plaza, Corner ... conventional change and patient perceived change adjusted for recall bias was also calculated for Table 1: Demographic information for participants included in analysis.Hospitalised older adults(n ... Queensland Medical Research Eth-ics Committee.Data AnalysisDemographic information including mean age, baseline and discharge health-related quality of life reports weretabulated (Table 1). Change...
  • 9
  • 367
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ