Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf
... AccessResearch Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in IrelandJohn F Menton*, Karen Kearney and John G MorganAddress: ... hospitals.Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developedbased on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validatedusing a ... assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concludedthat the predominant genotype circulating in these...
- 8
- 535
- 1
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt
... found that all positives belonged to the GII/4 variant of NoV.Conclusion: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method ... CentralPage 1 of 8(page number not for citation purposes)Virology JournalOpen AccessResearch Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection ... GI and GII NoV. The broad reactivity of the assay was vali-dated using a panel of stool samples collected containing5 GI and 9 GII NoV genotypes. The GI based NoV assay detected all five of the...
- 8
- 502
- 0
Báo cáo sinh học: "Radio wave propagation in curved rectangular tunnels at 5.8 GHz for metro applications, simulations and measurements" pot
... 15consists in a minimization of the path length, according to the Fermat Principle. Finally, an adaptive IMR has been developed based on the localization of reflection points. Results obtained in a ... results of literature in a straight arch-shaped tunnel. Then, comparisons with measurements at 5.8 GHz are performed in a curved rectangular tunnel. Finally, a statistical analysis of fast fading ... of the best examples of the use of such wireless radio system deployments based on WLAN, standards generally in the 2.45 or 5.8 GHz bands (New York, line 1 in Paris, Malaga, Marmaray, Singapore,...
- 32
- 458
- 0
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx
... approval and reviewprocesses, support for students and staff training and welfare. It has been piloted in Ghana and the feedback was incorporated into the handbook. The handbook is currently available ... penalties for plagiarism and collu-sion.4. Quality assurance of approval and review processesAimTo maintain the academic quality of courses and ensurethat courses remain relevant in the light of ... this aided the development of the handbook. The development of this handbook was participatory in nature.Results: The handbook addresses six main themes that are the minimum requirements that a...
- 5
- 488
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... Research was conducted in compliancewith the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involvinganimals and adhered to principles stated ... and Accreditation of Laboratory Animal CareInternational.Mouse adaptation The general approach to adapt MARV to mice was basedon virus passage in scid (BALB/c background) mice toavoid usage ... cortical cells of the zona fasciculata and zona reticularis at days 6 and 8.Use of the 'scid-adapted' MARV model to assess the efficacy of potential therapeutics for MARVTo demonstrate...
- 13
- 456
- 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... positivemacaques, the RV-2 assay result was low and outside the linear range of the assay. DiscussionWe have developed a TaqMan probe- based QPCR assay toquantitate the viral load of macaque rhadinovirusesbelonging ... from the antisense strand.OSM-Mn CCTCGGGCTCAGGAACAAC GTC TACTGCATGGCCCAGCTGCTGGACAA CTCAGACATGA CTGAGCCCACGAAGGCC OSM-AGM A OSM-Human A C.G T OSMa Primer OSM-FAM Probe OSMb PrimerStandard ... screen of the prevalence of RV2 rhadinoviruses in macaques housed at the WaNPRCDNA samples were obtained from PBMC of a randomassortment of thirty macaques housed at the WaNPRC and analyzed using...
- 12
- 509
- 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... design,data collection and interpretation. PG provided intellec-tual and theoretical input for the paper and interpretation of the findings. All authors were involved in revising the manuscript and ... working abroadetc [15]. Each line on the chart would have an eventnumber and a start and end date. Additional informationwas requested for nursing jobs, which included location,employing organization, ... nursing and if asked for in a sensitive way couldprovide a useful source of information both for career development and workforce planning. Finally researchersshould be wary of using satisfaction...
- 12
- 530
- 0
báo cáo sinh học:" Training evaluation: a case study of training Iranian health managers" docx
... each technique on a four-point scale (not at all satis-Importance of ways of learning about health planning and managementFigure 1Importance of ways of learning about health planning and management.0.0 ... purpose of the inter-views was to gain insights into the application and impact of the training, enrich the findings from the questionnaire and clarify uncertainties.All in- depth and group interviews ... place over the course of the trainingperiod with support from training mentors and line man-agers.This paper discusses the findings of an evaluation of the training conducted in Leeds and Tabriz...
- 14
- 562
- 0
báo cáo sinh học:" Migration as a form of workforce attrition: a nine-country study of pharmacists" pptx
... contributionsTW, SC and IB jointly formulated the study design,obtained and analysed the data, interpreted the findings and wrote the article. All authors had access to all data in the study and had final responsibility ... Mercer and Pascal Zurn, World Health Organization; and Anita Davies and Danielle Grondin (formerly IOM), International Organization for Migration, for their valuable input into the development of ... on the interest of local pharmacy student asso-ciations to participate and willingness to gather data, and included Australia, Bangladesh, Croatia, Egypt, Nepal, Sin-gapore, Slovenia, Portugal...
- 10
- 382
- 0
báo cáo sinh học:" Experience with a "social model" of capacity building: the Peoples-uni" ppt
... low-income settings. A number of challenges remain, includ-ing the ability to maintain a large volunteer workforce and to build partnerships and collaborations with otherorganizations.Competing ... collaborate with educational and other institutions in resource-poor settings, and hope thatthrough their use of Peoples-uni courses and/ or jointaccreditation of the academic awards, or other forms ... instigator(RFH), came together to help plan the initiative. After the creation of a charitable trust in the United Kingdom, some of these colleagues became trustees, and others becamemembers of an international...
- 5
- 444
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ