Báo cáo sinh học: " Evolution of naturally occurring 5''''''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
Báo cáo khoa học: DYRK1A phosphorylates caspase 9 at an inhibitory site and is potently inhibited in human cells by harmine pptx
... muta-tion of minibrain causes reduction of the size of the optic lobes and central brain hemispheres [4], whereasmice lacking one copy of the DYRK1A gene exhibit region- speci c reductions in brain ... Thr125. Recombinant His6–caspase 9 (His C9 ) or His6–caspase 9(T125A) (both containing the catalytically inactivating C2 87A mutation)was incubated with recombinant DYRK1A in the presence of [32P]ATP[cP] ... downstream of cyto-chrome c. J Biol Chem 280, 15449–15455.17 Martin MC, Allan LA, Mancini EJ & Clarke PR (2008) The docking interaction of caspase-9 with ERK2provides a mechanism for the selective...
- 13
- 317
- 0
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
... primer, 5¢-GCGCAAGCGCTTACGAAAATTCGTGCCGAAACTTGCA-3¢; 5T antisense primer,5¢-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCACGAA-3¢; 2.5T sense primer, 5¢-GCGCAAGCGCTTACGACTTAAAAAAATTGGTCAGAAAATCCAGG-3¢; 2.5Tantisense ... primers5¢-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAGGAGC-3¢ and 5¢-CCAGATCGCGGCCGCCTTGTACAGCTCGTCATGCCGAGAG-3¢; EcoRI and ApaI restrictionenzyme sites were introduced into the 5¢-end and 3¢-end of the Cerulean DNA fragment. ... following prim-ers: 5¢-GCTTCAGCTGGGATCCGGTGGTATGGTGA GCAAGG-3¢; and 5¢-CCAGATCGCGGCCGCTTAGTGGTGATGATGGTGGTGATGATGCTTGTACAGCTCGTCC-3¢. Following the His8-tag, a TAA stop codon wasinserted in...
- 16
- 329
- 0
Tài liệu Báo cáo Y học: Evolution of the enzymes of the citric acid cycle and the glyoxylate cycle of higher plants pdf
... toaccount for the origins of eukaryotes and their genes. The eukaryotic tricarboxylic acid cycle: an inhertancefrom eubacteria, but from which? The tricarboxylic acid cycle is a speci®cally ... eukaryotes,all of the enzymes of t he tricarboxylic acid cycle a re encoded in the nucleus. (A very similar situation exists for the Calvincycle in plastids, where almost of the genes of this typicallyeubacterial ... genomes to the nucleus during the course of evolution [19,20,84].Thus, one might expect all of the proteins of the tricarboxylic acid cycle to re¯ect an a-proteobacterialorigin, even though they...
- 16
- 474
- 0
Báo cáo khoa học: Evolution of the teleostean zona pellucida gene inferred from the egg envelope protein genes of the Japanese eel, Anguilla japonica potx
... Forward: GGAACTCAACGGTGGATTAGTReverse: CTCTACCACCAAGTGTTGGCTezpcd Forward: TTCCTACCTTCAAAGCATGGGReverse: GTGCTCAACTCAGGCATGTCAezpce Forward: CTCATTCTCTCCAGAAGCTGGReverse: GCTCCTAGACTCTGACACCAGEgg ... 227eZPCaeZPCbeZPCceZPCdeZPCeeZPCaeZPCbeZPCceZPCdeZPCeeZPCaeZPCbeZPCceZPCdeZPCeeZPCaeZPCbeZPCceZPCdeZPCeeZPCaeZPCbeZPCceZPCdeZPCeFig. 2. Alignment of amino acid sequences of the ZP domains of eZPCs. Conservedamino ... PAGE,and components of egg envelope containing sugar chainwere stained using the GelCode Glycoprotein Staining kit(Thermo Scienti c Inc., Rockford, IL, USA), according to the manufacturer’s instructions.Northern...
- 11
- 436
- 0
BÁO CÁO " SINH HỌC CỦA TÔM NƯỚC NGỌT MACROBRACHIUM IDAE (HELLER, 1862) Ở ĐẢO PHÚ QUỐC, VIỆT NAM THE BIOLOGY OF THE FRESHWATER PRAWN " doc
... (Heller, 1862). C c đ c tính hình thái c a c c mẫu tôm ở đảo Phú Qu c như dạng c a chủy, c a chân c thứ hai c a sinh vật đ c trưởng thành phát triển đầy đặn c ng giống với c c hình vẽ c a Heller ... xin đề nghị tiếp t c nghiên c u xem coi ở vùng nư c ngọt 343 (c c suối, c c bưng) c a đảo Phú Qu c còn c loài nào thu c giống Macrobrachium sinh sống (chia sẻ c trường) chung với loài này ... trên c a chân đuôi c ng c c c mụn này bao phủ (nhưng kích thư c hơi nhỏ hơn c c mụn trên mặt lưng c a đốt đuôi) và một số lông tơ, ngư c lại ở sinh vật đ c còn non và sinh vật c i thì không c ...
- 11
- 469
- 0
Báo cáo y học: "Low socio-economic status, smoking, mental stress and obesity predict obstructive symptoms in women, but only smoking also predicts subsequent experience of poor health"
... Women born in 1930, representative of women of the same age in the general population in 1968, were selected. Initially, 372 participants were included in the cohort. In 2000-2001, 231 of these ... this population, in which reduced PEF increased the risk of cardiovascular disease (CVD) and death twelve years later, independent of the presence of risk factors for CVD [2]. In this paper, ... perspective. In our study, smoking in 1968-1969 was related to reports of chronic bronchitis >30 years later. These results are in accordance with the results of the Copenhagen City Heart...
- 6
- 505
- 0
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx
... mechanism of zinc release is the modification of the cysteine lig-ands of zinc.Aldehydes increase the concentration of available cellular zincCultured human hepatocellular carcinoma (HepG2)cells ... proteins The effect of aldehydes on the zinc-binding capacity of zinc proteins was assayed by employing spectropho-tometry and the chromophoric indicator 4-(2-pyridyl-azo)-resorcinol (PAR) for zinc ... concentrations of aldehydes.A novel aspect of the molecular actions of aldehydes, e.g. acetaldehyde andacrolein, is their reaction with the cysteine ligands of zinc sites in proteinsand concomitant zinc...
- 11
- 473
- 0
Tài liệu Báo cáo khoa học: Peptides corresponding to helices 5 and 6 of Bax can independently form large lipid pores pdf
... remarks In summary, peptides corresponding to naturalsequences of Bax and encompassing individual helices of the characteristic a5–a6 hairpin domain can inde-pendently, and in the absence of tBid, ... pro-death proteins, such as cytochrome c, which are released into the cytoplasm as a consequence of apoptotic signals. The release of these apoptoticfactors involves alteration of the mitochondrial ... can improve packingat the rim and increase the stability of the pore. The latter is the case for lysolipids, such as lysoPtdCho (LPC), with positive intrinsiccurvature, and the HIIphase-inducing...
- 11
- 586
- 0
Báo cáo khoa học: 15 N-Labelled proteins by cell-free protein synthesis Strategies for high-throughput NMR studies of proteins and protein–ligand complexes doc
... proteins in the presence of other pro-teins provided in excess at the start of or during the reaction, e.g., for the purpose of rescuing nascentlyproduced insoluble proteins into soluble complexeswith ... be incomplete becausemany amino acid pairs occur more than once in the amino acid sequence. The basic combinatorial [15N]-labelling scheme of Fig. 1 provides the benefit of improved spectral ... occur in these spectra, becauseeach contains only about one third of the cross-peakspresent in the [15N]-HSQC spectrum of the corres-ponding uniformly labelled sample. Not a single caseof...
- 6
- 461
- 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt
... A-chain (PAC), its cDNA character-ization, expression of recombinant toxic A-chain(rPAC) in Escherichia coli, and the in vitro association of the rPAC and recombinant pulchellin binding chain(rPBC) ... activity determined by intraperitoneal injection in miceusing different concentrations of recombinant pulchellin A-chain(rPAC), recombinant pulchellin B-chain (rPBC), recombinant pulchel-lin ... under reducing(lane 1) and nonreducing (lane 2) conditions.Fig. 5. CD spectra of recombinant pulchellin A-chain (rPAC), recom-binant pulchellin B-chain (rPBC), recombinant pulchellin (rPAB)...
- 10
- 390
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ