Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx
Báo cáo sinh học: " Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple steps" pptx
... number not for citation purposes)Virology JournalOpen AccessResearch Expression of RNA virus proteins by RNA polymerase II dependent expression plasmids is hindered at multiple stepsNicola ... and premature polyadenylation prevent expression of RSV-F by RNA polymerase II dependent expression plasmids. Since RSV replicates inthe cytoplasm, the presence of premature polyadenylation sites ... transcription of viral cDNA by coex-pression of phage T7 RNA polymerase. Recovery of infec-tious viruses was achieved by cotransfection of T7 RNA polymerase dependent expression plasmids for...
- 10
- 409
- 1
Báo cáo sinh học: " Characterization of vaccinia virus A12L protein proteolysis and its participation in virus assembly" pptx
... mutant virus. References1. DeLange AM: Identification of temperature sensitive mutants of vaccinia virus that are defective in conversion of concate-meric replicative intermdediates to the mature ... con-firm that the A12L proteolytic processing is regulated by rifampicin (Fig. 2C). The hypothesis that the rifampicin-arrested proteolysis of A12L would be re-initiated by theremoval of the drug ... participations of the A12L-associated proteins throughout the progression of IV to IMV and IEVparticles suggest that the A12L may also be involved in multiple stages of virus morphogenesis.ConclusionIn...
- 12
- 495
- 0
Báo cáo sinh học: " Improvement of cardiac contractile function by peptide-based inhibition of NF-B in the utrophin/dystrophin-deficient murine model of muscular dystrophy" potx
... thehearts of most of dko mice in this study regardless of treatment (5 of 7 [71%] NBD treated mice, versus 3 of 4[75%] vehicle treated mice). Of note, the eight week-oldvehicle and NBD treated dko ... treatment of dkomice resu lted in an i mprovement in cardiac histopatho-logical features of this model. Between eight and tenweeks -of- age, dko mice display myocardial damage fol-lowed by ... contractile dysfunction is one of the leadingcauses of death in DMD. Clinical treatment of thisdebilitating aspect of DMD is paramount in extendingFigure 5 NBD is effective in inhibiting NF-B...
- 10
- 330
- 0
Tài liệu Báo cáo khoa học: Selection of stably folded proteins by phage-display with proteolysis docx
... advant-age of the computational methods is that they can examinevery large numbers of mutations [27]. The limitation of thecurrent computational methods, however, is that most of thecomputer ... lack of intrinsic consistency and reliability of the computationalmethods [35]. In comparison with the computationalmethod, the major limitation of the phage-display andproteolysis method is ... MINIREVIEWSelection of stably folded proteins by phage-display with proteolysisYawen Bai and Hanqiao FengLaboratory of Biochemistry, National Cancer Institute, Bethesda, MD, USATo facilitate the process of...
- 6
- 444
- 0
Báo cáo khoa học: Phosphorylation of NF-jB proteins by cyclic GMP-dependent kinase A noncanonical pathway to NF-jB activation potx
... phosphorylation of p49 by PKG but much less by PKA, and the phosphorylation of p65 by PKA and PKG on distinct residues implies multiple modes of regulation of NF-jB function. It also indicates thatthe ... pathway, associated with the T-cell antigen receptorthat is induced by superantigen and leads to activation of PKG and activation-induced cell death [3]. BecauseT-lymphocyte stimulation is often ... Substrate phosphorylation of p49 or p50depends on the presence of PKG and is enhanced by the addition of cGMP, whereascGMP in the absence of the kinase does notmediate measurable incorporation of...
- 12
- 341
- 0
Báo cáo khoa học: Modulation of the endocannabinoid system by focal brain ischemia in the rat is involved in neuroprotection afforded by 17b-estradiol pdf
... and water.Neuropathology and quantification of ischemicdamageCerebral infarct volume was evaluated 22 h after reperfu-sion in rats subjected to 2 h of MCAo. Rats were killed by decapitation, ... modulation by E2after MCAoFEBS Journal 274 (2007) 4464–4475 ª 2007 The Authors Journal compilation ª 2007 FEBS 4471modulation of the endocannabinoid system is implicatedin the mechanisms of ... separation was per-formed with a mobile phase of acetonitrile ⁄ water (70 : 30,v ⁄ v) at a flow rate of 1.0 mLÆmin)1. The concentration of AEA was quantified by comparison with knownamounts of...
- 12
- 460
- 0
Báo cáo sinh học: " Detection of virus mRNA within infected host cells using an isothermal nucleic acid amplification assay: marine cyanophage gene expression within Synechococcus sp" potx
... TCGTCTTCCGGTCTCTCCTCTCAAGCCTCAGCGCTCTCTCTCCCTATAGTGAGTCGTATTAATTTCGAAhACGTGACATTACATCACGCAAGTATTGTTxTCGTCTTCCGGTCTCTCCTCTCAAGCCTCAGCGCTCTCTCTCCCTATAGTGAGTCGTATTAATTTCGAAhACAGAAACAAGCTTGTTTACGATGGTCAAxFacilitator 1 TGCTTTTTATCATCACGAATCTCTCCTGTTxATGTTGGTAATCTACCAAAGGTAAAGGCAGxFacilitator ... efficiency of 3WJ formation is greatlyenhanced by the use of facilitator probes that anneal tothe target adjacent to the 3WJ. Only when specific targetnucleic acid is present, a T7 RNA polymerase ... [40], this would characteriseS-PM2 g20 mRNA as a mid to late transcript. However,recent work by Clokie et al [30] demonstrated that S-PM2only has 2 (early and late) classes of transcripts rather...
- 8
- 411
- 0
Báo cáo sinh học: " Soilborne wheat mosaic virus (SBWMV) 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing" docx
... PVX CP antiserum show similar levels of PVX.GFP virus (lanes 1–4) and PVX.19K virus (lanes 5–8). Lane 9 con-tains extract of non inoculated plants. (B) Northern analysis of RNA isolated from ... 15(3):269-280.11. Scholthof HB, Scholthof KB, Jackson AO: Identification of tomatobushy stunt virus host-specific symptom determinants by expression of individual genes from a potato virus X vector.Plant ... 19(7):1672-1680.10. Qiu W, Park JW, Scholthof HB: Tombusvirus P19-mediated sup-pression of virus- induced gene silencing is controlled by genetic and dosage features that influence pathogenicity. MolPlant Microbe...
- 11
- 356
- 0
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc
... the presence of IPTG exhib-ited ribosomal RNA degradation. This effect is mediated by RNase L since a similar pattern of rRNA cleavageproducts is observed by the co -expression of RNase L and2-5AS ... synthesis by the nonstructural proteins NS4Aand NS4B of hepatitis C virus. Virus Res 2002, 90:119-131.43. Kato J, Kato N, Yoshida H, Ono-Nita SK, Shiratori Y, Omata M: Hep-atitis C virus NS4A ... PKR which is active in both cell lines. Thisresult corroborates that apoptosis induced by HCVthrough RNase L is independent of the inhibition of pro-tein synthesis caused by PKR.DiscussionUnderstanding...
- 19
- 373
- 0
Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx
... by the addition of extra 3CDpro. Our results indicate that the stimulation of RNA synthesis and virus maturation by 3CDpro in vitro is dependent on the presence of a VPg-linked RNA template.Published: ... http://www.virologyj.com/content/2/1/86Page 14 of 19(page number not for citation purposes)sented in this paper indicate that the stimulatory effect of 3CDpro is both at the level of RNA synthesis and of virus maturation. Since ... templatesfor replication and packaging. This suggests that at leastone of the stimulatory functions of 3CDpro is required at the time RNA synthesis is initiated from the input VPg-linked RNA...
- 19
- 489
- 0
Từ khóa: báo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ