báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc

... This qualitative study was undertaken to understand how practicing doctors and medical leaders in Ghana describe the key factors reducing recruitment and retention of health professionals into remote ... in areas where you are not fully trained.” (UW)Occasionally a young doctor in GA complained aboutthe lack of hands-on practice in the teaching hospitals,but mentoring in GA was largely characterized ... back and then do a few things, but of late the internet [has been] fluctuating, so learning hasbeen off and on.” (UW) In larger towns of BA and in the capital of UW doc- tors mentioned that internet...

báo cáo sinh học:" Public-private partnerships to build human capacity in low income countries: findings from the Pfizer program" docx

... training to clinical and research personnel; strengthened laboratory, pharmacy, financialcontrol, and human resource management systems; and helped expand Partner organizationnetworks. Local ... Goals, issues of human and organizational capacity are becoming increasingly impor-tant [1]. Governmental and non-governmental organiza-tions alike are dealing with important capacity constraintswhich ... manually. Domain analysis wassubsequently conducted by a research team member and assistant. Quantitative data were analyzed using MicrosoftExcel and SAS v9.1 to produce frequency tables and...

báo cáo sinh học:" Major surgery delegation to mid-level health practitioners in Mozambique: health professionals'''' perceptions" pdf

... purpose of this study on health profession-als' perceptions and the first of its kind, was to documentthe opinions and attitudes of various health professionals toward TCs, using approaches and ... Corresponding author AbstractBackground: This study examines the opinions of health professionals about the capacity and performance of the 'técnico de cirurgia', a surgically trained assistant ... distinguishthe areas, not all [workers] are equal, and a nurse has threetraining years less than the TC. The TCs are being damaged in relation to wages". (Medical doctor, specialist,Maputo)Some interviewees,...

báo cáo sinh học:" Leveraging human capital to reduce maternal mortality in India: enhanced public health system or public-private partnership?" docx

... health workers in remote areas [64].While overall maternal mortality continues to decline in Tamil Nadu, there is a dearth of data on the impact of individual health system strengthening measures ... mortality rate (IMR) of 54 per1000 births, almost on par with the all-India average of 58. In contrast, Kerala had an IMR of 14, Maharashtra 36,Tamil Nadu 37, West Bengal 38, and Uttaranchal 42[50].With ... While that number was lower than the all-IndiaMMR of 301, it still came in well above Kerala and TamilNadu, at 110 and 134, respectively [49]. In that year, thestate also had an infant mortality...

báo cáo sinh học:" From staff-mix to skill-mix and beyond: towards a systemic approach to health workforce management" ppt

... constraints. International variations in thescope of practice of health care professionals suggest thatgroupings of skills into professions are often arbitrary and owe more to custom, traditions, ... guidelines protocols, and medications) and their appropriate utilisation. In thisrespect, a growing amount of evidence suggests that theautomation of clinical, financial, and administrativetransactions ... outlines some of the organisational and institutional factors needed to optimise HR in health care.These factors are important because they can help manag-ers, practitioners and policy- makers...

Báo cáo sinh học: " Intravenous ascorbic acid to prevent and treat cancer-associated sepsis?" pptx

... M, Kanda S, Hayashi T, Saito Y,Kanetake H: Predictive values of acute phase reactants, basic fetoprotein, and immunosuppressive acidic protein for staging and survival in renalcell carcinoma. ... Duconge J, Miranda-Massari JR, Gonzalez MJ, Jackson JA, Warnock W,Riordan NH: Pharmacokinetics of vitamin C: insights into the oral and intravenous administration of ascorbate. P R Health Sci J ... NYHA class III and IV heart failure to receive AA or placebo treatment.AA treatment (2.5 g administered intravenously and 3days of 4 g per day oral AA) Resulted in reductio n in circulating apoptotic...

Báo cáo sinh học: " Risk factors in the development of stem cell therapy" pdf

... patterns (e.g. growth factors, cytokines, chemokines)Extrinsic factors Manufacturing and handling- Lack of donor history - Disease transmission- Starting and raw materials - Reactivation of ... but also the safety data alreadyobtained with similar type of products. In additionextrinsic risk factors like manufacturing, handling, sto-rage- and clinical or treatme nt related risk factors ... data sug-gest that MSC can interact with cells of both the innate and adaptive immune system and can modulate theireffector functions leading to potent immunosuppressive and anti-inflammatory...

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... weaker due to the fact that two non-canonical G:Ubase pairs presented in the plus-sense RNA occur as non-pairing C /A bases in the minus-sense RNA. Interestingly, in Puumala hantavirus, a hairpin-like ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt831–855). To monitor the presence of recTULV S RNA,RT-PCR was performed with primers RECF738(5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Hairpin-like ... S RNA of TULV.GGAAAUG GCCAAGUG-C A- UG-C A- UU -A G GU -A G:UC A- UU -A 337 381(+) senseU:GU -A C UC-GU -A C-GU -A C-GU -A A-UC C A- UC A GU -A A-U(-) sense A C A- UG A G-C A- UCCUUUAC...

báo cáo sinh học:" Human resource leadership: the key to improved results in health" pptx

... service, finance, and education, and the private sector all have a role to play.Progress in dealing with these factors depends on manag-ers who are able to lead and inspire teams at all levels of the ... for health and in the health of populations – improvementsthat will last – managers need to know how to lead and how to influence HR changes within and outside theirorganizations. Leading and ... systems of leading and managing human resources for health do notwork in today's context. In these cases and others, a moreappropriate mode of leadership, linked to reforming man-agement...

Báo cáo sinh học: "Curcumin reduces expression of Bcl-2, leading to apoptosis in daunorubicin-insensitive CD34+ acute myeloid leukemia cell lines and primary sorted CD34+ acute myeloid leukemia cells" pptx

... Hussain AR, Al-Rasheed M, Manogaran PS, Al-Hussein KA, Platanias LC, Al-Kuraya K, Uddin S: Curcumin induces apoptosis via inhibition of PI3’-kinase/AKT pathway in acute T cell leukemias. Apoptosis ... performedusing a reverse transcriptase first strand cDNA synthesiskit (Takara, Japan). The sequences of the sense and anti-sense primers were: 5’ -CTGGTGGACAACATCGC-3’(sense) and 5’ -GGAGAAATCAAACAGAGGC-3’ ... KB,Sung B, Tharakan ST, Misra K, Priyadarsini IK, Rajasekharan KN, Aggarwal BB:Biological activities of curcumin and its analogues (Congeners) made byman and Mother Nature. Biochem Pharmacol 2008,...

Xem thêm