... fragment from the humantrypsinogen prepro sequence was amplified from humanpancreatic cDNA using the primer set (forward, CCCAAGCTTACCATGAATCTACTCCTGAT; reverse, GTTGGTACCTTGTCATCATCATCAAAGG), ... Sugimoto T, Ueyama H, Hosoi H, Inazawa J, Kato T,Kemshead JT, Reynolds CP, Gown AM, Mine H &Sawada T (1991) Alpha-smooth-muscle actin and des-min expressions in human neuroblastoma cell lines. ... activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for the indicated times. Whiteand shadowed bars indicate before and after activation by enterokinase,...