báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc
báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc
... be able to operate and sustain the new HRIS. A Local Area Network (LAN) was installed at the UNMC and staff received training about the administration and maintenance of the upgraded ICT system. Developing ... article as: Spero et al .: Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda. Human Resources for Health 2011 9:6.Spero et al. Human Resources ... Zuyderduin A, Kyobutungi N, Yumkella F: Job satisfaction and morale in the Ugandan health workforce. Health Affairs 2009, 28:w863-w875.22. Uganda Ministry of Health: Uganda Human Resources for Health...
- 10
- 535
- 0
báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx
... and retraining, including shifting as many tasks as possibleaway from doctors, nurses and pharmacists to non-clini-cal staff, enabling clinical staff to concentrate on their spe-cific areas ... growing rapidly and they need additional training, the team goes and assesses the needed training" [interview, national level, October2007]. The training helps build capacity of health care ... to the provincial health directorates in each ofZambia's nine provinces.While each of these interventions aims to alleviate the human resource shortage in relation to ART, examiningtheir...
- 9
- 594
- 0
báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf
... Mozam-bique, Tanzania, Uganda and Zambia have such cadreswho are doing essential medical tasks, especially in ruralareas [8]. In Malawi, clinical officers are a major resourceof the health sector; they ... in the literature review, study design,data collection and analysis. FM participated in the datacollection, data cleaning and preliminary analysis. MM and DH conducted the data analysis and ... to abolish the enrolled nursing programme in the early1990s and instead to focus on training registered nurses.Training of enrolled and auxiliary nurses was also stopped in Ghana and Zambia....
- 9
- 455
- 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
... anatomicopathologicmacroscopic and microscopic examinations and delivered clinical patients’data. All authors read and accepted the final manuscript.Competing interests The authors declare that they have no ... 04688945001TACTGCCCCACCATGACC CACGGCGTAGGAGACCACGNRH1 #29Roche Diagnostic, Cat. No: 04687612001GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTAHPRT Human HPRT Gene Assay (Roche Diagnostic, Cat. No: 05046157001)Figure ... Poznan, Poland.Authors’ contributionsAM, AS, AJ participated in the study design, carried out the moleculargenetic studies and performed data analysis. AJ has been involved in coordination...
- 9
- 460
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
... data workup, statistical analysis and drafted the manuscript, VSwas involved in technical assistance and in writing the manuscript, HDcarried out H&E staining and CK19 IHC, CS coordinated ... mandatory, in the OSNA assay amplification directlystarts from the lysate and therefore allows analysis of3-4 LN within 30-40 minutes and 12 LN within 2 hours.For the reason that increasing ... coordinated the study and drafted the manuscript, TP participated in the study design and drafted the manuscript, EN and MS added technical support and drafted the manuscript,KEM and WH participated in...
- 6
- 535
- 0
báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf
... anindividual basis at each facility. In some cases, training information was not yet entered into TIMS, and the part-ners collected all training information about the providers and their HIV/AIDS ... found that using information gathered in a standardized way by PEPFAR partners dur-ing routine supervision visits and entered into the TIMSdatabase demonstrates an innovative and effective way tomonitor ... President'sEmergency Plan for AIDS Relief (PEPFAR) and the GlobalFund to Fight AIDS, Tuberculosis and Malaria [3]. Human capacity building – including training service pro-viders in all areas...
- 8
- 364
- 0
báo cáo sinh học:" Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil" pdf
... formulated the study design. MCobtained the data. MC and AA were involved in the con-ceptualization, initial drafts and final write-up of the paper. All authors had access to all data in the ... HR Management Module in the ArteRH database at the MHS-BH did not containthis information. Analysis of the dataTwo main categories were used for the analysis of the data:full-time workers and ... cris.coelho@terra.com.br; Ada Ávila Assunção* - adavila@medicina.ufmg.br; Soraya Almeida Belisário - dadaja@medicina.ufmg.br* Corresponding author AbstractBackground: The fundamental importance of human...
- 13
- 544
- 0
báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot
... interests.Authors' contributionsPM and NCK conceived and coordinated the study and drafted the paper; PMcarried out the mathematical analysis; AT, DK, NS, NP and ET collected data and assisted in ... Mariolis A, Mihas C, Alevizos A, Papathanasiou M, Mariolis-Sapsakos T, Marayiannis K, Koutsilieris M: Evaluation of a clinical attachment in Primary Health Care as a component of undergraduate medical ... (Amsterdam, Netherlands) 2002, 62:15-29.21. Exadaktylos NM: Organisation and financing of the health care systems of Bulgaria and Greece what are the parallels? BMC health services research 2005,...
- 11
- 380
- 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... formal demonstration in a clinical trial using clinical grade virus preparations.Evaluation of the two vaccine candidates revealed thatthey are reasonable candidates for further study in clinicaltrials. ... performing the HAI assays and Emerito Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis. We also thank Brad ... for intranasal administration to infants and young children. The intranasal route of administra-tion is needle-free and has the advantage of direct stimu-lation of local immunity as well as induction...
- 13
- 504
- 0
Báo cáo sinh học: " Genetic characterisation of the recent foot-and-mouth disease virus subtype A/IRN/2005" pptx
... India99AF390623 A India99AF390659 A India2001AF390630 A India99AF390626 A India99AF390638 A India99AF390636 A India99AF390672 A India93AF390640 A India99AF390637 A India99AF390641 A India88AF390608 ... 2006OO A ASIA1ASIA1ASIA1, A, O A A22OOAsia1, A, O A AAsia1, A 0.1EF611987 Uganda 2006 AY593823 O1 Manisa AY687333 Asia1 India01 AY593799 Asia1 Leb4 AY593798 Asia1 Leb89 AY593800 Asia1 ... India01AY687334 Asia1 India97AY593800 Asia1 Leb83AY593798 Asia1 Leb89AY593799 Asia1 Leb4AF390612 A India88AF390652 A India97 AF390615 A India94AF390622 A India99AF390593 A India99AF390605 A India99AF390623...
- 12
- 556
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtthe ideas in the paper are new and exciting and perhaps the paper presents a new way of looking at an old problemto change the position of any graphic or box of click and drag the object to a new positionthe initial scientific research and development the idea for a new battery takes shapebáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ