báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot

báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot

báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot

... female physicians, the percentages of physicians working in rural areas and the average ages of physicians. The national population in these years was obtained by referring to the Japan Population ... contributions All the authors conceived the study and jointly designed and conducted it. HI and HY analysed the data and all the authors interpreted the r...
Ngày tải lên : 18/06/2014, 17:20
  • 10
  • 588
  • 0
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc

báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc

... in the 1998/99 academic year at the Universi- dade Eduardo Mondlane (UEM) Medical Faculty in Maputo, with the aim of identifying their social and geo- graphical origins and their expectations and ... selection of medical students, there are – in several countries including some in Africa – pro- grammes based on affirmative action aiming to increase the intake of me...
Ngày tải lên : 18/06/2014, 17:20
  • 7
  • 493
  • 0
Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx

Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx

... the mature ORF of RTA were CP172 5¢-ATATTCCCCAAACAATACCC-3¢ and the anti- sense primer CP133 5¢-TTAAAACTGTGACGATGGT GGA-3¢ with the TAA termination anticodon shown in bold. Amplification reactions ... ricin, in particular its route into target cells and the fate of its two subunits, RTA and the cell-binding galactose-specific lectin ricin toxin B chain (RTB), are essenti...
Ngày tải lên : 23/03/2014, 07:20
  • 14
  • 411
  • 0
Báo cáo sinh học: " Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" potx

Báo cáo sinh học: " Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" potx

... primers. ECD-forward: 5’ AAA CTC GAG ATG GAG CTG GCG GCC TTG T 3’ and reverse: 5’ CTT AAG CTT CGT CAG AGG GCT GGC TCT CT 3’ ;ICD-forward: 5’ AAACTCGAGAAGCGACGGCAGCAGAAG AT 3’ and reverse: 5’ CTT AAG CTT TCA ... analysis, HDB coordinated clinical aspects of the study including patient’s accrual and participated in drafting the manuscript, MHM conceived the study, designed the...
Ngày tải lên : 18/06/2014, 19:20
  • 5
  • 374
  • 0
báo cáo sinh học:" The training and professional expectations of medical students in Angola, Guinea-Bissau and Mozambique" pot

báo cáo sinh học:" The training and professional expectations of medical students in Angola, Guinea-Bissau and Mozambique" pot

... describe and analyze the professional expec tations of medical students during the 2007-2008 academic year at the public medical schools of Angola, Guinea-Bissau and Mozambique, and to identify their ... 2008. Some of the questions w ere context-specific and adapted to the rea- lity of each country. All data were entered into an Access database and analysed using S...
Ngày tải lên : 18/06/2014, 17:20
  • 5
  • 382
  • 0
báo cáo sinh học:" The human resource for health situation in Zambia: deficit and maldistribution" docx

báo cáo sinh học:" The human resource for health situation in Zambia: deficit and maldistribution" docx

... needs and to adapt training programs to include them; an example is that of training clinical care specialists, who are physicians who receive further training to assume clinical management ... use official data from 2008 to analyse various dimensions of the health workforce, such as vacancies, attrition, and geographical imbalances. The case of Zambia reinforces the idea...
Ngày tải lên : 18/06/2014, 17:20
  • 29
  • 327
  • 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... charac- terization of the NrfH subunit. The four NrfH hemes are all in a low-spin state (S ¼ 1/2). One of them has a g max at 3.55, characteristic of bis-histidinyl iron ligands in a noncoplanar arrangement, and ... desulfuri- cans ATCC 27774 NrfA [17] enabled to ascertain the spatial characterization of the five hemes, namely their proximity and the axial histi...
Ngày tải lên : 21/02/2014, 00:20
  • 12
  • 593
  • 0
Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf

Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf

... a oct+sAn aununS, with a oor~aAn smotmt oF nalIAenoln, and ~he more oaIAent a preoeaa As, 5he lar|er %5e %npae5 on oSher presences (and therefore on the overall prooeaoLng). There ere ... name tank. Than %e the evaluatAon 5eat oemmon%y used today For strafe.sial AntelIA|enee models. A more r~l;orous 5eat %e 5n Cry to F~.5 a mode/. 50 • emma OF data. ?hAs ~e t...
Ngày tải lên : 21/02/2014, 20:20
  • 4
  • 584
  • 0
Báo cáo khoa học: The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group docx

Báo cáo khoa học: The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group docx

... Szymanski and Jean-Robert Brisson Institute for Biological Sciences, National Research Council of Canada, Ottawa Ontario, Canada Campylobacter jejuni is one of the leading causes of human gastroenteritis ... gastroenteritis and surpasses Salmonella, Shig- ella and Escherichia in some regions as the primary cause of gastrointestinal disease [1–3]. There is also a convinci...
Ngày tải lên : 16/03/2014, 13:20
  • 15
  • 430
  • 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

... portable natural language data base interface. Cmlf. on Ap'1)lied Nc~t~ral L~znguage Processing, Santa Munica, Ca., 1983, pp. 25-30. 25. Grosz, B. TEAM: A transportable natural language ... grammatical formalism for transportable natural language processing, llm~r. J. Cow~p~t~zt~na~ L~n~ist~cs, to appear. Biermann, A. and Ballard, B. Toward natural language computation....
Ngày tải lên : 17/03/2014, 19:21
  • 5
  • 452
  • 0

Xem thêm

Từ khóa: