báo cáo sinh học:" Sending money home: a mixed-Methods study of remittances by migrant nurses in Ireland" docx
báo cáo sinh học:" Sending money home: a mixed-Methods study of remittances by migrant nurses in Ireland" docx
... strug-gling to meet their financial obligations in Ireland andback home. Increased taxes and the reduced availability of overtime have hit migrant nurses hard and yet their finan-cial obligations are ... emerging research themes. Further inductiveanalysis was conducted via a thorough re-reading of inter-view transcripts [19]. Data management and analysis werefacilitated by the use of the MaxQDA ... motivation for remitting, it would appearthat the financial burden of remittances occasionallyproved too great and that migrant nurses overstretchedthemselves financially in Ireland in order...
- 12
- 437
- 0
báo cáo sinh học:" “More money for health - more health for the money”: a human resources for health perspective" pdf
... in 2007 indicated that 25% of all fundsare allocated to human resources and training, and 42% of all activities in Board-approved Round 8 proposalsrelated to human resources and training [21]. ... the G8 as required by their annual AccountabilityFramework). The World Health Organization (WHO)‘working lifespan strategies’ is promoted as a roadmapfor training, sustaining and retaining the ... activities against the Agenda for Global Actionserved a dual purpose: to be one of the first bilateral agen-cies to classify British activities against each of the sixaction areas in the Agenda...
- 10
- 475
- 0
báo cáo sinh học:" Sharing best practices through online communities of practice: a case study" potx
... developmental status of students, allocation of scarce clinical and academic resources, space within analready crowded program of study and clinical compe-tency of available faculty must all be ... to analysis of GAPS forums: Barb Deller and Ricky Lu.Other moderators: Julia Bluestone and Barb Deller.Acquisition of data and monitoring of submissions: Karnika Bhalla andAlishea Galvin.Financial ... some-thing well, measured against a standard, especially abilityacquired through experience or training” [6]. This abilitytranslates into performance and may be measured ifstandards are clear and...
- 8
- 458
- 0
báo cáo sinh học:" The current shortage and future surplus of doctors: a projection of the future growth of the Japanese medical workforce" pdf
... Life Table.Pass rate for Japanesenational examination formedical practitionersPass rates remain constant at the rateachieved in the last decade (2000-2009).Male/female ratio of newmedical ... of the future growth of the Japanese medical workforceHideaki Takata1*, Hiroshi Nagata2†, Hiroki Nogawa3†and Hiroshi Tanaka4†AbstractBackground: Starting in the late 1980s, the Japanese ... quota which has been in placesince the 2007 increase (LDP), and that of increasingthe quota by an additional 50% (DPJ), are recognized asthe de facto policies of two major political parties.Given...
- 7
- 483
- 0
Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx
... Virginia. Data were analyzedwith FlowJo software (Treestar, Ashland OR).Testing of Blood Shipping PackagesThe standard shipping container used in our clinicaltrials was obtained from Safeguard ... found thatshipping of blood in insulated containers by contractedovernight carriers is associated with large seasonal varia-tions in temperature inside the packaging, ranging from-1°C in winter ... 9:26http://www.translational-medicine.com/content/9/1/26Page 3 of 13sections of the manuscript and editing. EF assisted in the gathering andorganization of shipping data. RJF was instrumental in concept of study. ARC assisted in the in vitro...
- 13
- 606
- 0
Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf
... ERCC1and XRCC1 and radioresistance in laryngeal tumors[33].Cetuximab is an IgG1 monoclonal antibody againstthe ligand-binding domain of EGFR. Cetuximab bindsTable 3 Univariate analyses of prognostic ... Chemotherapy added tolocoregional treatment for head and neck squamous-cell carcinoma:three meta-analyses of updated individual data. MACH-NC CollaborativeGroup. Meta-Analysis of Chemotherapy on ... Health 2007, 7:121.24. Thomas SJ, Bain CJ, Battistutta D, Ness AR, Paissat D, Maclennan R: Betelquid not containing tobacco and oral cancer: a report on a case-control study in Papua New Guinea...
- 8
- 689
- 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf
... 285:20252-20261.29.Wang S, Parker C, Taaffe J, Solorzano A, Garcia-Sastre A, Lu S: HeterologousHA DNA vaccine prime–inactivated influenza vaccine boost is moreeffective than using DNA or inactivated vaccine alone ... diseaseHayk Davtyan1,2, Anahit Ghochikyan1, Richard Cadagan3, Dmitriy Zamarin3, Irina Petrushina2, Nina Movsesyan2,Luis Martinez-Sobrido4, Randy A Albrecht3,5, Adolfo Garc a- Sastre3,5,6and ... vaccines against Abeta N-terminal or C-terminal domainsDavtyan et al. Journal of Translational Medicine 2011, 9:127http://www.translational-medicine.com/content/9/1/127Page 14 of 15influenza...
- 15
- 431
- 0
Báo cáo sinh học: " Periodic solutions for a class of higher order difference equations" potx
... equationsHuantao Zhu1and Weibing Wang∗21Hunan College of Information, Changsha, Hunan 410200, P.R. China2Department of Mathematics, Hunan University of Science and Technology,Xiangtan, ... improvethe article. The study was supported by the NNSF of China (10871063) and ScientificResearch Fund of Hunan Provincial Education Department (10B017).References[1] Agarwal, RP: Difference Equations ... Tphas a fixed point x ∈ Ω. The proof is complete. Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsAll authors contributed equally to the manuscript...
- 14
- 314
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... S RNA of TULV.GGAAAUG GCCAAGUG-C A- UG-C A- UU -A G GU -A G:UC A- UU -A 337 381(+) senseU:GU -A C UC-GU -A C-GU -A C-GU -A A-UC C A- UC A GU -A A-U(-) sense A C A- UG A G-C A- UCCUUUAC ... weaker due to the fact that two non-canonical G:Ubase pairs presented in the plus-sense RNA occur as non-pairing C /A bases in the minus-sense RNA. Interestingly, in Puumala hantavirus, a hairpin-like ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt831–855). To monitor the presence of recTULV S RNA,RT-PCR was performed with primers RECF738(5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) andHairpin-like...
- 5
- 483
- 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT AH1 GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
- 24
- 604
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ