báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot
báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot
... support and coopera-tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban District Health Management Team) for their assistance in study ... rates are high and before ART was available, death was a common cause of attrition among district health care workers [14,15]. A recent South African survey measured HIV prevalence among health ... study implementation and recruitment. We thank Moffat Zulu and Martin Daka of CIDRZ for providing data manage-ment and data entry assistance. We acknowledge the Zambian Ministry of Health for consistent...
- 10
- 501
- 0
Báo cáo sinh học: " Development and implementation of explicit computerized protocols for mechanical ventilation in children" pot
... robustness and reliability, and industry to finalize a product that will receive a European Community marking (CE mark) and a U.S. marking (Food and Drug Administration (FDA)) approval. Generation and ... protocols for mechanical ventilation? The human brain has a limited ability to incorporate data and information in decision making and human memory can simultaneously retain and optimally utilize ... The mismatch between human ability and the vast amount of data and information contributes to variation in clinical practice as decisions are made applying different data constructs and different...
- 26
- 435
- 0
báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot
... (Amsterdam, Netherlands) 2002, 62:15-29.21. Exadaktylos NM: Organisation and financing of the health care systems of Bulgaria and Greece what are the parallels? BMC health services research 2005, ... I, Papadakis V, Katsika A, Sarafidou J, Laskari H, Anastasopoulos I, Vessalas G, Bouhoutsou D, Papaevangelou V, et al.: Burnout, staff support, and coping in Pediatric Oncology. Support Care ... Symvoulakis EK, Markaki A, Vardavas C, Papadakaki M, Daniilidou N, Souliotis K, Kyriopoulos I: Integrated primary health care in Greece, a missing issue in the current health policy agenda: a systematic...
- 11
- 380
- 0
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging that is applicable to any tagging ... 504 Table 1: Four-Category Contingency Table ration, in which certainty ratings 0 and 1 are combined and ratings 2 and 3 are combined. Note that the analyses described in this section cannot ... validation is performed. The data is partitioned randomly into 10 different SFor the analysis in Table 3, certainty ratings 0 and 1, and 2 and 3 are combined. Similar results are obtained...
- 8
- 354
- 0
Báo cáo Y học: Engineering and use of 32P-labeled human recombinant interleukin-11 for receptor binding studies docx
... third PCR using two primers G353 (5¢-GGAATTCCATATGGACTACAAGGATGACGATGACAAG-3¢) and G354 (5¢-ATAGTTTAGCGGCCGCTCACAGCCGAGTCTTCAG-3¢) and the above plasmid astemplate. The expression plasmid pET-FCPDIL1 ... Verschueren) were maintained in DMEM containing 10% fetal bovine serum and 2 mMglutamine. All cell lines were maintained at 37 °Cand5%CO2.IL-11 bioassayIL-11 activity was measured using the IL-11-dependentmouse ... Sands, B.E., Bank, S., Sninsky, C .A. , Robinson, M., Katz, S.,Singleton, J.W., Miner, P.B., Safdi, M .A. , Galandiuk, S .,Hanauer, S.B ., et al. (1999) Preliminary e valuation of safety and activity...
- 8
- 419
- 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... for intranasal administration to infants and young children. The intranasal route of administra-tion is needle-free and has the advantage of direct stimu-lation of local immunity as well as induction ... AccessResearchAttenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genesEmmalene J Bartlett*, Adam Castaño, Sonja ... formal demonstration in a clinical trial using clinical grade virus preparations.Evaluation of the two vaccine candidates revealed thatthey are reasonable candidates for further study in clinicaltrials....
- 13
- 504
- 0
Báo cáo sinh học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx
... JournalOpen AccessResearchDetection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast AsiaHC Prasanna* and Mathura RaiAddress: Indian Institute of Vegetable ... Vegetable Research, P B 5002, P 0-B H U, Varanasi, Uttar Pradesh, 221005, IndiaEmail: HC Prasanna* - prasanahc@yahoo.com; Mathura Rai - mathura.rai@gmail.com* Corresponding author AbstractBackground: ... 2006) complete Indian, Pakistani, Chinese, Bang-ladeshi, Sri Lankan, Malaysian, Thai, Philippine and Tai-wanese tomato-infecting begomovirus DNA -A and DNA- A- like components (Table 2). These...
- 10
- 567
- 0
Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx
... bp) was based on the amplifi-cation of the YF T3 plasmid [6] with oligonucleotidesRG330 (5'CTCGGCATGG ACGAGCTGTACAAGAAGTT-GTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCCAAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTAGAGAC ... obtained after RNA transfection. Two independent series of serial passages (at MOI of 0.02); P1 and P2 were analyzed by RT-PCR and flow citometry at passages 5 and 10 and are represented in all ... genesMyrnaCBonaldo*1, Samanta M Mello1, Gisela F Trindade1, Aymara A Rangel2, Adriana S Duarte1, Prisciliana J Oliveira1, Marcos S Freire2, Claire F Kubelka3 and Ricardo Galler2Address:...
- 16
- 428
- 0
Báo cáo sinh học: "Construction and characterization of an infectious clone of coxsackievirus A16" docx
... Xba I CV(1–4392) amplification P3 CTACGCTCTAGAAAGAAGGA Xba I CV(4381–7410) amplification P4 ACAAGCGGCCGCTGCTATTCTGGTTATAAC Not I CV(4381–7410) amplification P5 CTTCTCGAGGTTGATTTTGAGCAAGCATTG ... study and wrote the manuscript. QL participated in the study design and data analyses. All authors read and approved the final manuscript. Acknowledgements We thank Drs Bing Sun and Qi Jin for ... detection of negative-strand RNA Viral RNA was reverse transcribed using primer P7 to detect negative-strand RNA (Table 1). The resultant first strand cDNA was used as a template for PCR amplification...
- 22
- 455
- 0
Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt
... Morishita R, Aoki M, Hashiya N, Makino H, Yamasaki K, Azuma J, Sawa Y,Matsuda H, Kaneda Y, Ogihara T: Safety evaluation of clinical genetherapy using hepatocyte growth factor to treat peripheral arterialdisease. ... of age, and male Wistar rats, seve n weeks of age, wereobtained from Japan Farm (Kagoshima, Japan) and Charles River Laboratories Japan Inc. (Yokohama,Japan), respectively. The animals were maintained ... mg/kg/day (C) (n = 4 for each), intravenously for 14 days, and urinary excretion of albumin and protein wasmeasured before (day 1), during (days 7 and 14), and 7 and 14 days after HGF administration....
- 12
- 567
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtcare—claims for and use of atypical antipsychotic drugs prescribed to children in medicaid newproduction and use of replication deficient adenovirus for transgene expression in neuronsestimation of the types of surgical procedures and cost of dd to the health care systemthe types of surgical procedures and cost of dd to the health care systembáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ