báo cáo sinh học:" Appropriate training and retention of community doctors in rural areas: a case study from Mali" pdf
báo cáo sinh học:" Appropriate training and retention of community doctors in rural areas: a case study from Mali" pdf
... implicationsAs the training consists to a large extent in compensatingfor shortcomings of the medical school-based training, a reasonable approach would be to incorporate this kind of training in the basic ... of doctors into rural first line practice –unusual in Sub Saharan Africa – lie in Mali's health sectorreform and health labour market evolution, as well as in an incentive package easing ... education and training retains and supports rural and remote doctors in Queensland. Rural Remote Health 2007, 7:700.33. Van Dormael M, Dugas S, Diarra S: North-South exchange and professional...
- 8
- 714
- 0
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... nothave any opinion.Regarding the quality of the training received, 52% felt itwas adequate or very adequate, 20% that it was inade-quate or very inadequate and the remainder did not haveany opinion.Expectations ... AccessResearchThe training and expectations of medical students in MozambiqueFernando Sousa Jr*1, João Schwalbach1, Yussuf Adam1, Luzia Gonçalves2 and Paulo Ferrinho1,3Address: 1Associação para ... (from 1 st to 7 th year of medicaleducation) on a specified day, during agreed lecture peri-ods, in April and May of 1999 (see Figure 2).All data were entered into an Access database and ana-lysed...
- 7
- 493
- 0
báo cáo sinh học:" Job satisfaction and motivation of health workers in public and private sectors: cross-sectional analysis from two Indian states" ppt
... satisfaction and motivation of health workers in public and private sectors: cross-sectionalanalysis from two Indian statesDavid H Peters1*, Subrata Chakraborty2, Prasanta Mahapatra3, Laura Steinhardt1AbstractBackground: ... differentapproach to arrive at random samples of healthworkers. In the case of AP, a database of public and privatefacilities was held by the Institute of Health Systems,which was updated through interviews ... which was conducted by a separate organiza-tion. To obtain a list of private providers, the startingpoint was a database of facilities maintained by the UPNursing Home Association, which was supplemented...
- 11
- 632
- 2
báo cáo sinh học:" The training and professional expectations of medical students in Angola, Guinea-Bissau and Mozambique" pot
... Medicine in Guinea-Bissau, is not currently integrated in any Univer-sity, and offers a training programme supported byCuban tutors. It was, at the time of the study, in itsthird year of training. The ... 2008. Some of thequestions w ere context-specific and adapted to the rea-lity of each country. All data were entered into anAccess database and analysed using SPSS. Statisticalanalysis was mostly ... (studentssurveyed in Mozambique included participants in theseventh year of training, whereas in Guinea-Bissau the training had just reached its fourth year) (Table 2). In Mozambique the most...
- 5
- 382
- 0
báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
... work in cardiovascular surgery.Possible impact of changes in initial clinical training systemJapan introduced a new clinical training system in 2004, and this will probably affect physicians' ... physicians, the percentages of physicians working in rural areas and the average ages of physicians. The national population in these years wasobtained by referring to the Japan Population Census and the ... 2009 in press.7. Ide H, Yasunaga Y, Koike S, Kodama T, Igarashi T, Imamura T: Short-age of pediatricians in Japan: a longitudinal analysis usingPhysicians' Survey Data. Pediatr Int 2009 in...
- 10
- 588
- 0
Báo cáo sinh học: " Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" potx
... primers.ECD-forward: 5’ AAA CTC GAG ATG GAG CTGGCG GCC TTG T 3’ and reverse: 5’ CTT AAG CTTCGT CAG AGG GCT GGC TCT CT 3’ ;ICD-forward:5’ AAACTCGAGAAGCGACGGCAGCAGAAGAT 3’ and reverse: 5’ CTT AAG CTT TCA ... Michael O Idowu2, Margaret M Grimes2, Laura Graham3, Maria-Libera Ascierto4,Ena Wang4, Xiang-Yang Wang5, Harry D Bear3 and Masoud H Manjili1*AbstractBackground: Emerging data from ... dataanalysis, MOI and MMG performed IHC analysis, LG prepared blood samples,M-LA, EW and X-YW participated in drafting the manuscript and dataTable 1 Patients’ characteristicsPatients Stage of tumor...
- 5
- 374
- 0
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... relatingto low potency and cost. Peptide-based drug candidatesare limited by insufficient efficacy and unfavorable phar-macokinetics. MAbs have increasingly gained favor in large part because ... HIV-1 OraSure Technologies, Inc. HIV/AIDS MarketCytolin CytoDyn Amerimmune Pharmaceuticals, Inc. HIV/AIDS I/IITipranavir TIPRANAVIR HIV/AIDS IIIHXB AAI International, AnaaiPharma Company Herpes ... infections, and also carry certain risk for a small, yet significantportion of the population. In the recent years, FDA's approval and subsequent market acceptance of Synagis, a monoclonal antibody...
- 6
- 568
- 0
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx
... African-Americans [6] and in African populations in Uganda, Zimbabwe, Tanzania,Central African Republic, South Africa and The Gambia[7-12]. In The Gambia, HSV-2 seropositivity amongyoung adults from ... designed a rapid PCR-based assayto quantify and type HSV in cervicovaginal lavage (CVL) fluid of subjects attending a Genito-UrinaryMedicine (GUM) clinic. Vaginal swabs, CVL fluid and venous ... and the HSV primerswith the addition of M13 primer sequences [HSV-M13forward 5'-TGTAAAACGACGGCCAGTAGCCTGTAC-CCCAGCAT-3'; HSV-M13 reverse 5'-CAG-GAAACAGCTATGACCTGGGCCTTCACGAAGA-3'].Cycling...
- 10
- 458
- 0
Báo cáo y học: "Refractive Status and Prevalence of Refractive Errors in Suburban School-age Children"
... prevalence of refractive errors. Quality Assurance All investigators and staff involved in this re-search participated in an intensive two-day training. Demographic data were collected by qualified ... demonstrated that age had a sig-nificant influence on the prevalence of hyperopia and myopia: as age increased, the prevalence of hyperopia markedly decreased, and that of myopia significantly increased. ... er diagnosis and treatment. Data Management and Analysis Household selection and clinical examination data were reviewed for accuracy and completeness before the computer-aided data entry....
- 12
- 551
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ