0
  1. Trang chủ >
  2. Kỹ Thuật - Công Nghệ >
  3. Điện - Điện tử >

báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx

báo cáo sinh học:

báo cáo sinh học:" Managerial competencies of hospital managers in South Africa: a survey of managers in the public and private sectors" docx

... These include planning, organ-izing, leading and controlling. Planning involves defininggoals and mapping out ways to reach them; organizingentails arranging and coordinating human, material and information ... a survey of hospital manag-ers in the public and private sectors in South Africa, using a self administered questionnaire. The survey was con-ducted among all managers of public hospitals in ... CentralPage 1 of 7(page number not for citation purposes)Human Resources for HealthOpen AccessResearch Managerial competencies of hospital managers in South Africa: a survey of managers in the...
  • 7
  • 503
  • 0
báo cáo sinh học:

báo cáo sinh học:" Health workforce responses to global health initiatives funding: a comparison of Malawi and Zambia" docx

... and central hospitals.Facility managers reported that workload, which hadbeen a long-standing and worsening problem in Malawi,was being tackled in several ways, including: training and rot ating additional ... with the nationalcollation of PMTCT data, which was the responsibility of a separate section of the Ministry of Health to thatcollating ART data. In Zambia, there was a steadyincrease in numbers ... 52% of all health workers and 24% of doctors live and work in rural areas where two thirds of Zambiansreside [23], and there are high vacancy rates and a rapidturnover of staff in rural areas...
  • 13
  • 423
  • 0
báo cáo sinh học:

báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

... purposes)remain, further increasing turnover [9]. The implications of these findings are therefore alarming for the provision of health care in South Africa now and in the future, giventhat we are already ... Pillay R: Effect of organisational structure and managerial practices on the clinical behavior and job satisfaction of pri-mary healthcare doctors as knowledge workers, in the man-aged healthcare ... and ineffective in terms of meeting its mandate of accessible, affordable and appropriate health care. The private sector, on the otherhand, is reputed for its world-class facilities and care...
  • 10
  • 514
  • 1
báo cáo sinh học:

báo cáo sinh học:" Training health care workers to promote HIV services for patients with tuberculosis in the Democratic Republic of Congo" pptx

... developing the training. AVR conceived of the study, participated in developing the training, coordinated the study with FB and helped to draft the manuscript. All authors read and approved the final ... consisting of a partici-pant's manual, a trainer's manual, Power Point® slides, a training evaluation questionnaire and the revised treat-ment card can be obtained from the correspondingauthor. ... HIV and TB care in this resource-poor setting. Involvement of the National TB and HIVProgram staff in the development phase facilitated the use of the training materials by the National Program...
  • 9
  • 650
  • 0
báo cáo sinh học:

báo cáo sinh học:" Conflict among Iranian hospital nurses: a qualitative study" ppt

... effectively.Limitations The main disadvantage of the qualitative approach is that the findings cannot be replicated for a larger populationwith the same degree of certainty that quantitative analy-ses ... individual and cultural characteristics of the patientpopulation and their family members were another work-place issue in various teaching hospitals. Because teachinghospitals are economically accessible ... 2006,5:3.32. Dehghan Nayeri N, Nazari A, Salsali M, Ahmadi F, Adib Hajbaghery M:Iranian staff nurses' views of their productivity and manage-ment factors improving and impeding it: a qualitative study.Nursing...
  • 8
  • 354
  • 0
báo cáo sinh học:

báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt

... – including migrant nurses from a range of countries; varying in age, marital status and dura-tion of working in Ireland; active and passive recruits; and those working in both the public and ... anunderstanding of meaning in complex data through the development of summary themes or categories from the raw data" [26]. Data management was facilitated by the use of the MaxQDA qualitative data analysis ... to ensure that the quantity of data remainedat manageable levels. A point of data saturation wasquickly reached – the point at which the researcher feltthat increasing the number of respondents...
  • 12
  • 495
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial ce" pptx

... p38mitogen activated protein kinase (p38), nuclear factor of activated T cells (NFAT), c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK), and protein kinaseC/activator protein-1 ... Relative quantitation was determined using the comparative CT method with data normalized to 36B4mRNA and calibrated to the average ΔCT of untreated con-trols.Statistical analysisData are ... design and data interpreta-tion. CAM participated in experimental design, data inter-pretation and manuscript preparation. DES participated in experimental design, data interpretation and manu-script...
  • 9
  • 458
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia'''' docx

... spinalcord. The primary sequelae are clinical manifestations of dysarthria, dyscoordination of limbs, instability of gait, and eventual loss of posture [1-3]. Spinocerebellar ataxia(SCA) and ... analyzed and interpreted data and helped to draft the manuscript. XH conceived of the study, participated in its design and coordination and helped to draft the manuscript. All authors read and approved ... the auspices of the National Ministry of Health. Patients were explained the experimental nature of the procedure and informedconsent was obtained from all patients before initiation of treatment....
  • 5
  • 324
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA" ppt

... onset of WNV RNATable 1: Small interfering RNAName Virus Start Nucleotide Target SequenceCap WNV Lineage I 312 gaacaaacaaacagcgatgaaCap-Mut WNV Lineage I 312 gaagaaagaaagaccgatgaaM2 Influenza ... 8898 cagcaatgcagctttgggt9095 WNV Lineage I 9095 gaagcagagccatttggtt9607 WNV Lineage I 9607 gggaaaggacccaaagtca10355 WNV Lineage I 10355 gagagatatgaagacacaacsiRNA were generated against 19–21 ... gtgtcaaggaggatcgact5039 WNV Lineage I 5039 gacggtgatgtgattgggct5497 WNV Lineage I 5497 gcagcaagaggttacattt6337 WNV Lineage II 6337 gttgaagtcatcacgaagt6349 WNV Lineage I 6349 gtggaagtcatcacgaagc6915...
  • 13
  • 340
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Research Article One-Dimensional Compressible Viscous Micropolar Fluid Model: Stabilization of the Solution for the Cauchy Problem" pot

... dτ,3.24Boundary Value Problems 5 In the proof of Theorem 2.1, we apply some ideas of 4 and obtain the similar resultsas in 5 where a stabilisation of the generalized solution was proved for the classical ... in Mathematics and Its Applications, North-Holland,Amsterdam, The Netherlands, 1990.4 Ja. I. Kanel’, The Cauchy problem for equations of gas dynamics with viscosity,” Sibirski˘ıMatematicheski˘ı ... constants, we firstderive a priori estimates for the solution independent of T. In the second part of the work weanalyze the behavior of the solution as T →∞. In the last part we prove that the...
  • 21
  • 231
  • 0

Xem thêm

Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtvaluing things the public and private meanings of possessionsthe public and private meanings of possessionsbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ