Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... Walker3AbstractBackground: The complex data sets generated by higher-order polychromatic flow cytometry experiments are a challenge to analyze. Here we describe Exhaustive Expansion, a data ... as: Siebert et al.: Exhaustive expansion: A novel technique for analyzing complex data generated by higher-order polychromatic flow cytometry experiments. Journal of TranslationalMedicine 2010 ... 70:1362-1364.18. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H,Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T,Imaizumi T: Therapeutic angiogenesis for patients...
- 15
- 476
- 0
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx
... Delaware, Newark, DE, USA and 2Department of Mechanical and Aeronautical Engineering, Civil and Environmental Engineering, and Land, Air, and Water Resources, University of California, Davis, ... patternthat produced the maximum force-time integrals and themaximum peak forces (Fig 8). For example, at -25°/s themaximum force-time integral for both predicted andmeasured data occurred at an ... experimental force data to evaluate the parameters (see SectionB.5). Theexperimental force is measured in a Kin-Com machine by placing a force transducer above the ankle joint (seeEquipment and experimental...
- 20
- 466
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Zhao Z, Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM. A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral ... followed by incubation with a reporter antibody (HRP–conjugated anti–rabbit IgG, Santa Cruz Biotech, CA). The assay was developed using a stabilized HRP substrate. All samples were analyzed ... the manufac-turer’s procedure (Clontech, CA). Briefly, mouse Vgf cDNA (Salton, unpublished data) was isolated via Xba I-Apa I restriction cleavage, and cloned into the NheI-ApaI sites of a pShuttle...
- 8
- 499
- 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx
... ATG s tart codon) for cDNA synthesis and 5¢-CCGTGATTGTTGAGTGGATG-3¢ and 5¢-AAGCAACTCCAGTAGACACG-3¢(position 386–405 and 769–750, respectively, from theATG s tart codon) for PCR amplification. ... obtained fromKatakura Kogyo (Matsumoto, Japan), and the larvae werereared on an artificial diet as d escribed previously [16].Tissues were dissected f rom 5-day-old fi fth-instar lar vae,washed ... Technology and Medicine, London SW7 2AZ, UK;2Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, JapanSugar conjugation is a major pathway for the inactivationand excretion...
- 7
- 470
- 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
... Purandare AV, Chen Z, Huynh T, Pang S, Geng J,Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar-aman L (2008) Pyrazole inhibitors of coactivator associ-ated arginine methyltransferase 1 (CARM1). ... of SAM analogs is a logical strategy for the direct inhibition of PRMTs. As a SAM analog,sinefungin can compete for SAM binding and inhibitthe activity of all SAM-dependent methyltransferases,including ... Electrothermal9300 capillary melt apparatus and are uncorrected. NMRspectra were recorded using an Inova-400 spectrometer(Varian, Palo Alto, CA, USA) (400 MHz for 1H, 100 MHz for 13C) in...
- 13
- 646
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG5 1028 A. Ray et al. ... the SAF-1/MAZ/Pur-1family, is expressed during inflammationAlpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2and Bimal K. Ray11 Department of Veterinary Pathobiology, ... was used as the template for the second PCR.The SAF-3 primers for the second PCR primers were5¢-CCGCCATGGAT CCCAGCAACTGGAGCAGC-3¢(forward) and 5¢-GAGAACCGGGAGCAAGTCCAC-3¢(reverse). The amplification...
- 11
- 439
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as the only open readingframe ... 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. The plasmid pFL38-RAS2 was con-structed by ligating ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢,...
- 8
- 485
- 0
Báo cáo khoa học: BGN16.3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt
... Trichoderma harzianum.Mol Gen Genet 247, 639–645.19 Oyama S, Yamagata Y, Abe K & Nakajima T (2002)Cloning and expression of an endo-1,6-beta-d-glucanasegene (neg1) from Neurospora crassa. Biosci ... sequenced. Two 14 and 13 amino acidsequences were obtained, respectively. These were:N-terminal: Ala-Ala-Gly-Ala-Gln-Ala-Tyr-Ala-Ser-Asn-Gln-Ala-Gly-AsnInternal peptide: Gly-Leu-Asn-Ser-Asn-Leu-Gln-Ile-Phe-Gly-Ser-Pro-TrpBoth ... Educacion y Ciencia, Spain, andL. Sanz was a recipient of a fellowship from Junta deAndalucia, Spain. We thank Andres Soler for his help-ful advice on biochemical techniques and R. Sanchezfor...
- 8
- 327
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaacgcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctgggaagcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ (reverse);MACS1 5¢-gagttggagctccaagctgg-3¢ (forward), ... 5¢-cttcctgtgtcaagtggcag-3¢ (for- ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggctatcg-3¢ (reverse). Hybridization, washing, antibody reactionand ... primers for o-macs, SA, KS, KS2 andMACS1 are as follows: o-macs,5¢-atgaaggttctcctccgctg-3¢(forward), 5¢-gcctttcgggacaaggagcc-3¢ (reverse); SA 5¢-aggtgttttcagcgcctagc-3¢ (forward), 5¢-caccattactctgtctcctc-3¢...
- 10
- 393
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23...
- 9
- 444
- 0
Từ khóa: sim a novel technique for assessment of local topological properties of porous and irregular structuresbáo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quotlựa chọn xây dựng và sử dụng hệ thống bài tập hoá học phần hóa đại cương lớp 10 ban nâng caobài báo cáo môn học hóa vô cơ nâng caochuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ