Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
... this article as: Ehlén et al.: Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer. Journal of Translational ... Access Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancerÅsa Ehlén1, Donal J Brennan2, Björn Nodin1, Darran P ... demonstrated that increased expression of the RNA-binding protein RBM3 is associated with a favourable prognosis in breast cancer. The aim of this study was to examine the prognostic value of RBM3 mRNA...
- 12
- 531
- 0
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... (5¢)3¢) Antisense primer (5¢)3¢) GenBank acc. no.COX IV a AGAAGGCGCTGAAGGAGAAGGA CCAGCATGCCGAGGGAGTGA NM_009941NRF-1 ATGGGCCAATGTCCGCAGTGATGTC GGTGGCCTCTGATGCTTGCGTCGTCT AF098077b-actin GAACCCTAAGGCCAACCGTGAAAAGAT ... explain the lack of the effect of the transgene on the size of the latter depot [16,17]; this is also associated with the differential effect of the transgene on in situ fatty acidsynthesis i ... biogenesis and upregulateits c o-ordinating factor, the nuclear respirato ry factor-1(NRF-1). In animals treated with b3-adrenoreceptoragonists [43], the metabolic rate was relatively high and the...
- 10
- 555
- 0
Báo cáo hóa học: " Incidence of the V600K mutation among melanoma patients with BRAF mutations, and potential therapeutic response to the specific BRAF inhibitor PLX4032" potx
... research; RH, in charge of analyzing tumor specimens and participated in writing the manuscript. All authors have read and approved the final manuscript.Competing interests The authors declare ... the BRAF mutation analysis; AB,collected tumor material and established melanoma cells in culture; HMK,participated in writing of the manuscript; DN, excised tumors and provided the material ... showed that in BRAF wild-type melanoma cells, PLX4032 stimulated the downstream intracellular signaling pathway, causing celldetachment and motility in metastatic melanoma cells and enhancing cell...
- 3
- 349
- 0
Báo cáo khoa học: Mutation of epidermal growth factor receptor is associated with MIG6 expression docx
... upstream signalingdynamics, which concomitantly regulate the dynamics of the original pathway. Kinases and effector proteins in the EGFR-mitogen-activated protein kinase(MAPK) cascade are particular ... the KEGG pathway database, PubMedabstracts and the Entrez Gene database, including Gene-RIF. ErbB and MAPK signaling pathway-related genesT. Nagashima et al. EGFR mutation and MIG6 expression FEBS ... containing (SHC), mitogen-activated protein kinase kinase (MEK) and extracellular signal-regulated protein kinase (ERK) in the absence or presence of EGF (Figs 6B and S1B). Interestingly, MIG6 expression showed...
- 13
- 347
- 0
báo cáo hóa học: " Participation of MCP-induced protein 1 in lipopolysaccharide preconditioning-induced ischemic stroke tolerance by regulating the expression of proinflammatory cytokines" pdf
... becoming increasingly clear that inflammation and innate immune response play an important role in the brain injury after ischemic stroke [26, 27]. Inflammatory mechanisms that are activated within ... before MCAO. (A) Infarct images obtained by TTC staining at 48h after MCAO. The normal tissue was stained deep red and the infarct was stained milky. (B) Brain infarcts were assessed 48 hours after ... mice after brain ischemia, we examined the activation of JNK/c-jun signaling pathway. The phosphorylation of JNK and c-jun significantly increased in mice after brain ischemia/reperfusion and absence...
- 38
- 422
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... promoters indicate the a- F1-ATPase GAF/Adf-1 bindingcassette has enhancer properties. (A) The basal promoter activity of b-F1-ATPase is greatly increased when the a- F1-ATPase GAF/Adf-1 bindingcassette ... nucleosomestructure a nd activate transcription both in vitro and in vivo [38].To analyse the involvement of the potential GAF and Adf-1 binding sites in activating the a- F1-ATPasepromoter, we eliminated the ... The 56 bp region essential for promoter activity is boxed, and the GAGA and Adf-1 elements in the DNA are underlined. The translation start codon and the main transcription start point are larger...
- 11
- 532
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... that the Vma3p was indispensable for the assembly of subunits A and B. Hirata et al. [19] investigated the functions of Vma11p and Vma16p in the S. cerevisiae V-ATPasecomplex, and reported that ... vector In the case of AACEVAPD1, 3 and 6, TAA is used as anAcetabularia-specific codon usage (translated as Gln).Conversion of TAA to CAA was performed by PCR asdescribed below.AACEVAPD1 has two ... roles of isoforms as observed in higher plants V-ATPase. We have also isolated twodifferent cDNAs coding for the subunits A and B of V-ATPase. The intracellular localization of these isoformsand...
- 8
- 391
- 0
Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc
... concentrations and a negative control on the UTPconcentration.Materials and methodsBacterial strains and plasmids The strains and plasmids used in this study are listed in Table 1. Plasmid pCJ31B contains ... contains the L. lactis pyrG gene, and was made from a PCR-product made with prim-ers pyrG1 1a (5¢-GTAGAAGCTAAAATCTGG-3¢ )and SLLH7 (5¢-TACAAAAGATTTTGGGC-3¢) cloned in the TOPO TA cloning kit from Invitrogen. ... perfectly in line with the theory of metabolic supply and demand analysis [24]. This theorypredicts that for biosynthetic pathways, such as thoseleading to the biosynthesis of amino acids or...
- 8
- 489
- 0
Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf
... raised against the P. cinnabarinus laccase. The Western blot analysis show ed a unique band corresponding to the 70-kDa protein demonstrating that this protein is the recombinantlaccase.Northern ... mass of t he native laccase and and 10% for the recombinant l accase. I n the heterologous production of the P. cinnabarinus lac case in P. past oris [14] or the T. villosa laccase in A. oryzae ... All the characteristics of the recombinantlaccase are in agreement with those of the native laccase. This is the first report of the production of a white-rot laccase in A. niger.Keywords:laccase;Pycnoporus...
- 8
- 495
- 0
Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx
... We investigated the pattern of expression of aralar1 and citrin in murine embryonic and adult tissues at the mRNA and protein levels. Insituhybridization analysisindicates that both isoforms are ... citrin and aralar1 were performed in parallel and reincubated with anti-(b-F1ATPase). Aralar1 was detected with an antibody directed against its N-terminus, or against Aralar1 amino acids 507–520 ... hybridization and compared with that of citrin .In contrast with the situation in the adult animal, this studyshows that there is a wide overlap in the expression of the Fig. 3. Expression of aralar1...
- 8
- 432
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam