0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học:" Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary artery disease: a randomised cross-over study" potx

báo cáo hóa học:

báo cáo hóa học:" Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary artery disease: a randomised cross-over study" potx

... purposes)Journal of Translational MedicineOpen AccessResearch Static platelet adhesion, flow cytometry and serum TXB2 levels for monitoring platelet inhibiting treatment with ASA and clopidogrel in coronary ... (r2 = 0.49). Data included are from all three separate anti -platelet treatments (ASA and clopidogrel alone as well as ASA and clopidogrel combined).Journal of Translational Medicine 2009, 7:42 ... data regarding adhesion to collagen in the presenceof Mg2+ showed that both adrenaline and LPA induced a weak albeit significant decrease in platelet adhesion. Sinceboth LPA and adrenaline...
  • 14
  • 521
  • 0
báo cáo hóa học:

báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx

... foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the"appropriate" parameters for a cell based cytometry assay,we validated a MCP-1 internalization ... less than 10% across all individuals and all days (Table 5). In- study resultsThis assay was used as a pharmacodynamic marker for biological activity of a CCR2 antagonist in a clinical trialconsisting ... researcher to determine CCR2 satura-tion and a pharmacodynamic-pharmacokinetic relation-ship in clinical trials investigating CCR2 ligandantagonists.Competing interestsDrs. Wyant and Green are...
  • 12
  • 829
  • 0
báo cáo hóa học:

báo cáo hóa học: " Effect of optical flow versus attentional strategy on gait in Parkinson''''s Disease: a study with a portable optical stimulating device" pptx

... induce a facilitation ofwalking in PD subjects, due to the bypass of the affectedneural pathways, i.e. the basal ganglia. In fact, it has beenshown that basal ganglia play a primary role in ... regulation in Par-kinson's disease: the use of extrinsic, visual cues. Brain 2000,123:2077-2090.6. Martin JP: Locomotion and the basal ganglia. In The basal ganglia and posture Edited by: Martin ... RP participated in the design of the study, dataanalysis and helped to draft the manuscript. MT partici-pated in data analysis and performed the statistical analy-sis. AM participated in the...
  • 9
  • 467
  • 0
báo cáo hóa học:

báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf

... Pharmingen) and anti-VE-Cadherin-PE (eBio-science), or Annexin-FITC and 7-Amino Actinomycin D(7-AAD BD Pharmingen) and analyzed by FACS. Onceagain to assess cellular viability an aliquot of ... (InvitrogenCarlsbad, CA) and quantitative PCR was performed using2 ng of total cDNA and SYBRgreen (Applied Biosystem;CD52, 5'primer CTTCCTCCTACTCACCATCAGC,3'primer CCACGAAGAAAAGGAAAATGC).HistologyImmunofluorescence ... normal tissues. FACS analysis of VLC in (A) Ficoll isolated tumor associated host cells and (B) normal tissues as indicated. CD45 stain is indicated on the X-axis and VE-Cadherin stain is indicated...
  • 14
  • 728
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " miR-17-92 expression in differentiated T cells - implications for cancer immunotherapy" docx

... ELISA and technical editing of themanuscript. TAR, JM and MTL participated in the design of experiments and interpretation of data. EW and FMM performed the miR microarray and assisted with analysis. ... primary authors,was one of the two primary writers of the paper, and heavily participated in experimental design and data analysis. All authors read and approved thefinal manuscript.Competing ... Kornmann M: Interleukin-4 enhancesproliferation of human pancreatic cancer cells: evidence for autocrine and paracrine actions. Br J Cancer 2005, 92:921-928.13. Seo N, Hayakawa S, Takigawa M,...
  • 12
  • 381
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Epidermal growth factor receptor gene copy number in 101 advanced colorectal cancer patients treated with chemotherapy plus cetuximab" doc

... primer (5'-AGGCCTGCTGAA AATGACT-GAATA-3'), 10 pmol K-ras antisense primer (5'-CTG-TATCAAAGAATGGTCCTGCAC-3'), and 1 U of Taqpolymerase (Resnova). An additional no-template controlcontaining ... RM: FISH analysis. IS: statistical analysis. EM: DNA extraction and k-rasmutation analysis. SC: DNA extraction and k-ras mutation analysis. MGD: patho-logical sample evaluation. MZ: acquisition ... acquisition of data. GP: in acquisition of data.FC:drafting the manuscript; CG: study design, acquisition, analysis and interpre-tation of data; drafting the manuscript. All authors read and approved...
  • 8
  • 472
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Non-monotonic changes in clonogenic cell survival induced by disulphonated aluminum phthalocyanine photodynamic treatment in a human glioma cell line" pot

... uptake and localization ofphthalocyanine and drafting of the manuscript. VJ con-ceived the study and participated in its design and coordi-nation and helped in interpretation of data and draftingthe ... cellular transport and intracellular localization, (b) complex interactionsbetween photobleaching and singlet oxygen quenching athigh intracellular densities of AlPcS2 and its aggregates and ... between surviving fraction and energy (KJ)was quantified by modeling the data with a univariate lin-ear regression analysis with energy being an independentvariable and surviving fraction as dependent...
  • 14
  • 521
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

... mandatory, in the OSNA assay amplification directlystarts from the lysate and therefore allows analysis of3-4 LN within 30-40 minutes and 12 LN within 2 hours. For the reason that increasing ... data workup, statistical analysis and drafted the manuscript, VSwas involved in technical assistance and in writing the manuscript, HDcarried out H&E staining and CK19 IHC, CS coordinated ... (DCI)DCI was performed after the original analysis. OSNAruns were repeated from discordant sample homoge-nates and afterwards RNA was isolated and subjectedtoqRT-PCRforCK19,CEA,andbeta-actin.Condi-tions...
  • 6
  • 535
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " S110, a novel decitabine dinucleotide, increases fetal hemoglobin levels in baboons (P. anubis)" potx

... was amplified by tworounds of PCR using semi-nested primers. The primer setBG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC)were used in the first round and BG2 and ... ical agents that can elevate fetal hemo-globin have great potential as therapeutic agents. TheDNA methyltransferase (DNMT) inhibitors 5-azacytidine and 5-aza-2’deoxycyidine (decitabine) have ... S110reagent.CS, and RI performed the pharmacokinetic analysis. DL, YS, and JDinterpreted the data and wrote the manuscript. All authors read and approved the final manuscript.Competing interestsDL,...
  • 8
  • 443
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Translational Medicine is developing in China: A new venue for collaboration" ppt

... Translational Medicine and integrated the information aboutChinese data with the broader scope of theJournal of Translational Medicine.All authors read and approved the final manuscript.Wang ... American and Chineseentities [12]. Several Universities are also becomingincreasingly interested in supporting Translationalefforts and several collab orate with the local govern-ments and/ or ... editorial board has both a broad-based interest for Translational Medicine and expertise in specific areas relevant to the discipline [18-20]; addi-tional subsections are in the making not necessarilydedicated...
  • 5
  • 312
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròbáo cáo khoa họcbáo cáo y họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP