city of a million legends
city of a million legends
... she's another Balachandran." They all shuddered. Balachandran had been a high HP official and mastermind of an attempt to take over the galaxy by using a Wild Interface. "If this's ... stones are restorations. "Sirwini legend has it that this was the actual site of the City of a Million Legends. At least, there are about a million legends native to this part of Sirwin, as ... sumptuous as the rest of the Epitasis. When Zref was shown in, she was at ease in a huge chair behind a gleaming glassite desk. At the side of the desk, standing to attention was a human male arrayed...
- 82
- 358
- 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc
... Val216 decides the substrate speci city of a- glucosidaseinSaccharomyces cerevisiaeKeizo Yamamoto1, Akifumi Nakayama2, Yuka Yamamoto1,* and Shiro Tabata11Department of Chemistry, Nara ... Matsuura, Y., Kusunoki. M., Harada, W. & Kakudo, M. (19 84)Structure and possible catalytic residues of Taka-amylase A. J. Bi ochem. 95, 697 –702.4. Nakajima, R., Imanaka, T. & Aiba, ... fromPierce Chemicals. La-Taq polymerase was purchased fromTakara Syuzo and restriction endonucleases and T4 DNAligase were from Takara S yuzo, or New En gland Biolabs.Reverse transcriptase was used...
- 7
- 452
- 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... ¢-CGCTACAGCCTCCTACNNNATCGAAGGTGCTTGG-3¢, w ith AAC and GAG as themutated codons for Q39N and Q39E, respectively. Formutation at position E451, the primer sequence was5¢-GGAGTCTAATGGACAACTTTNNNTGGATGGAGGGTTATATTGAGCG-3¢,withGAC,CAAandTCAas ... Investigation of the substrate speci city of a b-glycosidase fromSpodoptera frugiperdausing site-directed mutagenesis andbioenergetics analysisSandro R. Marana, Eduardo H. P. Andrade, Cle´lia ... designated 4 and 6, where ÔeÕ stands for an equatorialhydroxyl and a for a n axial one. Therefore, the interactionbetween any residue at position 39 and an equatorial 4-OHwas called /4e, and...
- 9
- 371
- 0
Báo cáo khoa học: Functional characterization and Me2+ ion specificity of a Ca2+–citrate transporter from Enterococcus faecalis1 pdf
... Microbiologı´ a, Facultad de Ciencias Bioquı´micasy Farmace´uticas, Universidad Nacional de Rosario, ArgentinaAnalysis of a large set of bacterial genomes has shownthat, in spite of its high abundance ... of the family reveals that thethree members associated with the fermentative citratepathways of S. mutans, S. pyogenes and E. faecalis areon a separate branch of the tree that is well separatedfrom ... Ca2+,Ba2+,Sr2+,Zn2+,Ni2+,Mg2+,Mn2+, and Co2+were added at a final concentration of 2 mM.Cu2+,Cd2+and Pb2+were added to a final concentration of 1.1 mM. Uptakewas expressed as a percentage of the uptake obtained in a buffer...
- 10
- 386
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... tabacumUGT75C1 A. thalianaUGT75B1 A. thalianaUGT75D1 A. thalianaUGT84B1 A. thalianaUGT8 4A1 A. thalianaFaGT2 FragariaxananassaUGT78D1 A. thalianaUGT8 6A1 A. thalianaUGT8 7A1 A. thalianaUGT8 3A1 ... A. thalianaUGT76C1 A. thalianaUGT71B1 A. thalianaCaUGT1 C. roseusUGT71C1 A. thalianaUGT71D2 A. thalianaUGT8 8A1 A. thalianaUGT72E2 A. thalianaUGT72E3 A. thalianaUGT72E1 A. thalianaUGT72D1 ... pilosellaSlUGT5 S. lycopersicumBAG80556 L. barbarumUGT9 1A1 A. thalianaUGT91B1 A. thalianaUGT91C1 A. thalianaUGT79B1 A. thalianaUGT89C1 A. thalianaUGT89B1 A. thalianaUGT8 9A1 P A. thalianaUGT9 2A1 ...
- 11
- 661
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... Ontario, Canada) or NewEngland Biolabs (Pickering, Ontario, Canada). All otherchemicals were of analytical grade and were obtained fromSigma-Aldrich and Fisher Scientific (Nepean, Ontario,Canada).Bacterial ... University of Guelph, Ontario, CanadaMicrobial degradation of aromatic compounds isimportant for maintaining the global carbon cycle andalso for the bioremediation of man-made aromaticcompounds, ... differences in active site residues amongmembers of this group of hydratases, may also have a bearing on catalytic rate.Substrate speci city of the first four enzymes in themeta-cleavage pathway has been...
- 9
- 461
- 0
Báo cáo khoa học: Probing the determinants of substrate specificity of a feruloyl esterase, AnFaeA, from Aspergillus niger doc
... S13 3A S13 3A- A CATCGACGCTCCCAGAGCATGGCCTGTCACGGTAAG S13 3A Y80V-S GCTCGATACTAACGTCACGCTCACGCCATTCG Y80VY80S-S GCTCGATACTAACTCCACGCTCACGCCATTCG Y80SW260V-S GATGACGAGCGGAGCTTGTACTGTGTAGTAGAAGC W260VW260V-V ... GCTTCTACTACACAGTACAAGCTCCGCTCGTCATC W260VW260S-S GATGACGAGCGGAGCTTGTACTTCCTAGTAGAAGC W260SW260S-V GCTTCTACTAGGAAGTACAAGCTCCGCTCGTCATC- W260STable 4. Data collection and refinement statistics ... Crystal structure of the S13 3A AnFaeA mutant in complexwith FAXX. (A) Molecular surface of S13 3A AnFaeA mutant. Thecatalytic triad and the Y80 and W260 residues are labelled. Ferulicacid molecule...
- 10
- 382
- 1
Tài liệu Effect of a school-based oral health education programme in Wuhan City, Peoples Republic of China ppt
... were calibrated against a master examiner. The kappastatistic was used to assess theinter-examiner reliability of cariesand the final kappa scores werehigher than 0.8518. Data on oralhealth ... use of oral healthservices, implementation of school-based oral health care programmes,adoption of regular self-carepractices and use of fluoride tooth-paste57. Against this, increasinglevels ... is measured interms of effect on dental cariesexperience and oral health habits of children, and oral health knowl-edge, attitudes and behaviour of mothers. In addition, levels of oralhealth...
- 9
- 587
- 0
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf
... Councill of State for the Management of the Poste affaire Whereas John Teage who hath formerly beene actually in Armes for ye Parliamt and since that being an Inhabitant of this Citty hath beene ... coat -of- arms. A band of music with horns played several tunes adapted to the day, and a recruiting party drawn up before the doors with drums and fifes playing at intervals had a very pleasing ... PALMER'S MAIL COACH INNOVATIONS, 1660-1818. The King's Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and...
- 158
- 673
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ