feynman, vernon theory of quantum system interacting with a linear dissipative system

feynman, vernon. theory of quantum system interacting with a linear dissipative system

... ...

Báo cáo khoa học: Accumulation of polyubiquitinated proteins by overexpression of RBCC protein interacting with docx

... protein degradation. Proc NatlAcad Sci USA 98, 1012–1017.17 Sakata E, Yamaguchi Y, Kurimoto E, Kikuchi J,Yokoyama S, Yamada S, Kawahara H, Yokosawa H,Hattori N, Mizuno Y et al. (2003) Parkin binds ... Institute of Scientiﬁc and Industrial Research, Osaka University, Japan2 Laboratory of Industrial Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, Japan3 Department of Nanobiology, ... subunit of 26S proteasomes through itsubiquitin-like domain. EMBO Rep 4, 301–306.18 Hiyama H, Yokoi M, Masutani C, Sugasawa K, Maek-awa T, Tanaka K, Hoeijmakers JH & Hanaoka F(1999) Interaction...

PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx

... visual air quality and physical indicators such as color and contrast in a landscape. Flachsbart and Phillips (1980) used physical data for a variety of air pollutants and weather indicators and, ... vs. Americans Risk Analysis 9(3): 401-405 Koushki P A, Al-Fadhala S, Al-Saleh O, and Aljassar A H. 2002 Urban air pollution impact of modal shift in school transportation in Kuwait Journal ... being aware of air pollution, people in an industrial area of India did not feel it was a matter of concern because of other problems they faced (Bladen and Karan 1976). However differences across...

Báo cáo khoa học: "Enhancing a large scale dictionary with a two-level system" potx

...

Detection of an uncharged steroid with a silicon nanowire field effect transistor

... and surface modiﬁcation at variedstages, such as a treatment with APTES and also with BS3 and pro-tein as shown in Fig. 3. Fig. 3 also presents SEM images of AuNPon derivatized surfaces. As ... addition of 19-NA atvarious concentrations, the conductance of ArtKSI/mA51-labeledSiNW-FET rapidly increased to a constant value [Fig. 5(b)]. 19-NA at a greater concentration resulted in a greater ... Pharmacia) for chromato-graphic separation. The column was eluted with phosphate buffer(20 mM, pH 7.5) at a ﬂow rate 1 mL/min and a linear gradient2.5 mM/min of NaCl. KSI was eluted in a range...

Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx

... form appearing in both cases atTable 1. Sequences of the PNA derivatives studied.Compound SequenceMAP KLALKLALKALKAALKLA-NH2I Fluos-GGAGCAGGAAAG-Lys(antisense)II Fluos-GGAGCAGGAAAG-MAP(antisense)III ... Consistent with previous reports about substan-tially enhanced bioavailability of P NA after conjugation with natural CPPs [3–8], an almost one order of magnitudehigher intracellular PNA concentration ... intracellularavailability of PNAIn order t o e xamine the ability of M AP to de live r PNA intointact cells, we investigated the cellular uptake of theconjugate of I withMAPincomparisonwiththatofnakedI,...

Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

... to )124 region of c-juninteracts with a positiveregulatory factor in rat liver and enhances transcriptionDipali Sharma*, Sujata Ohri and Aparna DixitGene Regulation Laboratory, Center for ... )124 of c-jun and stimulates transcription.Materials and methodsReagents and animalsAll chemicals were of reagent grade and were from SigmaChemical Co. unless stated otherwise. Healthy femaleinbred ... regulatedat two different levels. Immediately after stimulation with 12-O-tetradecanoylphorbol 13-acetate (TPA), a post-trans-lational event leads to an increased activity of pre-existingJun/AP-1...

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

... Molecular Graphics System. DeLano Scientiﬁc, San Carlos, CA, USA.41 Wallace AC, Laskowski RA & Thornton JM (1995)LIGPLOT: a program to generate schematic diagrams of protein–ligand interactions. ... topology with sixb-strands (bAtobF) and two a- helices (aA and aB)(Fig. 4). The structure of the C378G variant of SAP97PDZ2was practically identical to that of C378Svariant, except for the mutated ... expression of surface GluR -A andAMPA receptor mediated synaptic currents [16].SAP97 may also play a role in the endocytosis of GluR -A AMPA receptors, based on identiﬁcation of a ternary complex...

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green ﬂuorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... CCATGCCTATGATACTGGGAT-3¢GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢GSTM2-revA ... 4AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8AS-7 GAGTAGAGCTTCATCTTCTC CDS 397–426 – 1AS-8ACTGGTCAAGAATGTCATAA CDS 480–499 – 7AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0AS-10 CAGGCCCTCAAACCGAGCCA ... 5AS-2 CCACTGGCTTCTGTCATAGT CDS 119–138 119–138 0AS-3 GAAGTCCAGGCCCAGTTTGA CDS 152–171 152–171 0AS-4 TCAATTAAGTAGGGCAGATT CDS 175–194 175–194 0AS-5 TCTCCAAAACGTCCACACGA CDS – 285–304 4AS-6...

Báo cáo y học: "Identification of Cellular Membrane Proteins Interacting with Hepatitis B Surface Antigen using Yeast Split-Ubiquitin System"

... designed as follows: 5’-TTAGGCCTAAAAATGGAGAACATCACATCAGGA-3’ 5’-AAAACAGAGACCCATATGTAAATTGGTACCAATT-3’ The amplified PCR product was cloned into the binding domain vector pTMBV4 in-frame with ... proteins interacting with a bait of interest [5], it can not be applied in the isolation of those interacting with transmembrane bait proteins such as HBsAg. A yeast split-ubiquitin screening system ... yeast split-ubiquitin system. Sequence analysis revealed three interacting cellular membrane proteins as summarized in Table 2. Table 2. Summary of Cellular Membrane Proteins Interacting with...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật