rna polymerase and associated factors, part c

Nutritional Status and Associated Factors in Institutionalized Elderly docx

... of muscle mass was observed in 21.2% of subjects, according to CP and AMBc. According to the CC classication, 59.4% of the seniors were at risk of complications associated with obesity and 70.3%, ... Muscle Area - -Severe muscle decit 11 21,2Decit mild muscle 7 13,5Normal muscle 30 57,7Excess muscle 2 3,8Muscle increased 2 3,8Waist circumference* - -Very high risk of complications associated ... calf (CP), arm (AC), waist (WC) and Hip circumference (HC), Waist / hip ratio (WHR), Triceps skinfold (TSF) and adjusted arm muscle area (AMBc). All measurements were obtained in accordance with...

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCChp2b hp2br GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG(–)IRES LDH2s TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGALDH2 CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTTLDH2r ... DSLA1 GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACGDSLA1 5’341T7TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT(–)IRES DHp2s TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCTDhp2 AGCCATGGTTTDHp2r ... AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGGTCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA(–)IRES 239rTAATACGACTCACTATAGGGGCACGCCCAAATCTC239 5’S2 GCCAGCCCCCTGATGGGGGCGA(–)IRES 219r AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC219...

Báo cáo khoa học: DNA polymerase e associates with the elongating form of RNA polymerase II and nascent transcripts pot

... eukaryotic cells. We describe here a speci c physicalinteraction between DNA polymerase e and RNA polymerase II, evidencedby reciprocal immunoprecipitation experiments. The interacting RNA polymerase ... interaction is not con-ﬁned to a speci c stage of the cell cycle. This is consis-tent with immunoelectron microscopy, revealing that RNA Pol II and Pol e colocalize throughout the cellcycle. ... RNA pol II (antibody N20). No difference in focalstaining and colocalization was detected at different time points.Staining Particles counted Particles in centres Particles colocalizing Nuclei...

Báo cáo khoa học: Investigating RNA polymerase II carboxyl-terminal domain (CTD) phosphorylation ˆ Benoıt Palancade and Olivier Bensaude pptx

... 2,43–53.43. Rickert, P., Corden, J.L. & Lees, E. (1999) Cyclin C/ CDK8 and cyclin H/CDK7/p36 are biochemically distinct CTD kinases.Oncogene 18, 1093–1102.3866 B. Palancade and O. Bensaude ... the Associationpour la Recherche sur le Cancer (ARC 6250), the Ligue NationaleContre le Cancer (Comite´de Paris) and the Agence Nationale deRecherche sur le SIDA.References1. Corden, J.L. ... HIV-1 transcription? Transcription factors, splicing factors, cellcycle regulators [155]Ó FEBS 2003 RNA polymerase II CTD phosphorylation (Eur. J. Biochem. 270) 3863Global changes in RNAP II...

Báo cáo Y học: Distinct parts of minichromosome maintenance protein 2 associate with histone H3/H4 and RNA polymerase II holoenzyme pptx

... pGEX-MCM2(169–212) and pFLAG-MCM2(1–230)plasmids was conducted using the Quikchange site-direc-ted mutagenesis kit (Stratagene). 5¢-CCGCTTCAAGAACTTCCCGGGCACTCACGTCAC-3¢ was used asa primer to introduce changes ... atpositions 192/193, and 5¢-GCCACGGCCACAACGAGCTCAAGGAGCGCATCAGC-3¢ was used to introducechanges from VF to EL at positions 203/204. Pointmutations were conﬁrmed by nucleotide sequencing.AntibodiesAnti-(Pol ... indica-tedthattheinteractionbetweenMCM2andMCM4,6,7islocated in the C- terminus of MCM2. Previously character-ized complexes of MCM2 such as RLF-M and MCM2,4,6,7 [51,54,55] consist of single molecules of thesix or four MCM...

Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

... from Roche (Switzerland). The p12 DNA oli-gonucleotide (5¢-GTCTTTCTGCTC-3¢), the tC5U RNA oligonucleotide (5¢-CCCCCUCUCAAAAACAGGAGCAGAAAGACAAG-3¢) and the 12mer DNA oligonucleotideF. Esposito ... 0.1aCompound concentration required to reduce enzyme activity by 50% ± SD.bCompound concentration required to reduce the HIV-1-induced cytopathic effect in MT-2 cells by 50%. c Compound concentration ... function. In the second step, a mixed quantummechanical ⁄ molecular mechanics method is used to com-pute the ligand charge distribution. For quantum mechani-cal ⁄ molecular mechanics calculations,...

Báo cáo khóa học: Three cyclin-dependent kinases preferentially phosphorylate different parts of the C-terminal domain of the large subunit of RNA polymerase II potx

... characterizationof recombinant CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1Earlier studies have provided important information on thesubstrate preferences of CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1. ... modifica-tions and the corresponding enzymes could have additionaleffects on the substrate specificities of CDK7/CycH/MAT1,CDK8/CycC and CDK9/CycT1. These effects are beyondthe scope of the current ... systematic comparison of theactivity of CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1 towards recombinant CTD substrates. We expressed and purified all three recombinant kinases from insect cellsfollowing...

Báo cáo khoa học: Aptamers toEscherichia colicore RNA polymerase that sense its interaction with rifampicin, r-subunit and GreB ppt

... transcription cycle, R NAP makes speci c and nonspeci c contacts with double and single stranded(ss) DNA, the RNA/ DNA hybrid and nascent RNA. Recent advances in structural studies of bacterial and ... ssDNA aptamers against Escherichia coli coreRNAP. The minimal nucleic acid scaﬀold (an oligonucleo-tide construct imitating DNA and RNA in elongationcomplex), rifampicin and the r70-subunit ... tRNA to Escherichia coli RNA polym eras e. Eur.J. Biochem. 99, 187–201.49. Altmann, C. R., Solow-Cordero, D.E. & Chamberlin, M.J. (1994) RNA cleavage and chain elongation by Escherichia coli...

Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx

... research, RNAP is currently the subjectof renewed interest and excitement, owing to recentpublication o f the crystal structures o f t he core [4] and holo[5,6] enzymes, and of an RNAP–DNA complex ... living cells and bacteria, rifampicinis particularly effective against intracellular p athogens, suchas Mycobacterium tuberculosis, for which i t is one of themost widely used chemotherapeutic ... previously described [23]; G E23077 wasisolated and i ts physico-chemical properties c haracterized asdescribed previously [19].All o ther chemicals were purchased from standardcommercial sources as...

chromatin and chromatin remodeling enzymes, part c

... 279(2000).16 chromatin modiﬁcation and remodeling [1]TABLE IVGCN5: ACase Study in Principles of Histone Modification and FunctionChromatin-modifier characteristic Gcn5p example1. Substrate specificity ... 12fdeAc Rpd3 transcriptionalrepression defectf17K12 Ac Hat1 telomeric silencingdefecti38DNA repair defect 39K16 Ac Sas2 telomeric and HMsilencing defect(40–43)K16 deAc Sir2 transcriptional ... mutateORF or catalytic domain of candidate enzyme and look for change in histone modification as above c Correlate enzymatic activity withcellular functionMutate candidate enzyme and assay phenotyped(see...

560
1,087
0

Xem thêm