Báo cáo Y học: A neuropeptide Y receptor Y1-subfamily gene from an agnathan, the European river lamprey doc

... A neuropeptide Y receptor Y1 -subfamily gene from an agnathan, the European river lamprey A potential ancestral gene Erik Salaneck1, Robert Fredriksson1, Earl T. Larson1, J. Michael ... subtypes. The mammalian Y1 , Y4 and y6 subtypes are < 50% identical at the amino-acid level, and form the Y1 subfamily. The Y2 and Y5 genes are only 30% identical to each other and toeach member ... identity to all previously cloned Y1 -sub-family receptors including Y1 , Y4 , and y6 and the teleostsubtypes Ya, Yb and Yc. Phylogenetic analyses point to a closer relationship with Y4 and Ya/b/c...

Tài liệu Báo cáo khoa học: Epidermal growth factor receptor in relation to tumor development: EGFR-targeted anticancer therapy doc

... lung can-cer with epidermal growth factor receptor mutations. BrJ Cancer 95, 998–1004.16 Sutani A, Nagai Y, Udagawa K, Uchida Y, KoyamaN, Murayama Y, Tanaka T, Miyazawa H, Nagata M,Kanazawa ... 3340–3346.15 Asahina H, Yamazaki K, Kinoshita I, Sukoh N,Harada M, Yokouchi H, Ishida T, Ogura S, Kojima T,Okamoto Y et al. (2006) A phase II trial of geﬁtinib asﬁrst-line therapy for advanced non-small ... factor receptor gene muta-tion in patients with non-small cell lung cancer.J Thorac Oncol 2, 22–28.18 Sunaga N, Tomizawa Y, Yanagitani N, Iijima H,Kaira K, Shimizu K, Tanaka S, Suga T, Hisada...

Tài liệu Báo cáo khoa học: A facile method for expression and puriﬁcation of the Alzheimer’s disease-associated amyloid b-peptide pdf

... GGGTTCT AACAAGGGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGACCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATTCCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTACACAACGCCACCAACCATCAG-3¢. The ... Ab(1–40) and Ab(M1–40) are at least 97%pure. In the lanes containing Ab(1–42) and Ab(M1–42), there were prominent bands at approximately4 kDa and faint bands at approximately 14 kDa. The band at approximately ... Monomeric A b is indicated by an arrow and an Ab42species migrating at approximately 14 kDa is indicated by an arrow and an asterisk.D. M. Walsh et al. Expression and puriﬁcation of the amyloid...

Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc

... Stochastic analysis of lexical andsemantic enhanced structural language model. The 8thInternational Colloquium on Grammatical Inference(ICGI), 97-111.K. Yamada and K. Knight. 2001. A syntax-based ... Stochastic analysis of structured lan-guage modeling. Mathematical Foundations of Speechand Language Processing, 37-72, Springer-Verlag.D. Jurafsky and J. Martin. 2008. Speech and LanguageProcessing, ... chainsare efﬁcient at encoding local word interactions, the n-gram model clearly ignores the rich syntactic andsemantic structures that constrain natural languages.As the machine translation...

Tài liệu Báo cáo khoa học: "A Limited-Domain English to Japanese Medical Speech Translator Built Using REGULUS 2" doc

... light make the headacheworse?” as a variant for “Is the headache aggra-vated by bright light?”, and “Do you usually haveheadaches in the morning?” as a variant for “Does the headache usually occur ... phrasebook translator, it has many desir-able properties. In particular, operations on semanticrepresentations typically manipulate lists rather thantrees. In a broad domain, we would pay a heavyprice: ... Hospital2500 Grant RoadMountain View, CA 94040vvandal3@aol.comHitoshi Isahara, Kyoko KanzakiCommunications Research Laboratory3-5 HikaridaiSeika-cho, Soraku-gunKyoto, Japan 619-0289{isahara,kanzaki}@crl.go.jpBeth...

Tài liệu Báo cáo khoa học: "A Text Input Front-end Processor as an Information Access Platform" doc

... English' and &apos ;a pen'. 3 The Japanese terms Shoseki and Renzu mean, respectively, 'written materials' and &apos ;a lens'• 4 The Japanese terms Reibun and Bainda ... Miyazaki, Miyamae-ku, Kawasaki, KANAGAWA 216-8555 JAPAN s-doi@ccm.cl.nec.co.jp, kamei@ccm.cl.nec.co.jp, yamabana@ccm.cl.nec.co.jp Abstract This paper presents a practical foreign language writing ... retrieved automatically but displayed only on user command. After automatic retrieval, only the quantity of information is displayed, and users can decide whether to display it. C) Information is...

Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx

... segments of an utterance by cooperatively using both grammatical and n-gram based statistical language constraints, and uses a robust parsing technique to apply the grammatical constraints described ... Hoteru yoyaku gakari de gozaimasu", ('l'hank you for calling Kyoto Kanko Hotel reservations.) Input String: -¢, " ;A hai arigatou gozaimasu e Kyoto Kanko Hoteru yanichikan ... and the latter as the Correct-Part respectively). These parts are extracted from the speech recognition results and the corresponding actual utterances, then they are stored in a database...

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

... Odintsova1, Alexander A. Vassilevski2, Anna A. Slavokhotova1,Alexander K. Musolyamov2, Ekaterina I. Finkina2, Natalia V. Khadeeva1, Eugene A. Rogozhin2,Tatyana V. Korostyleva1, Vitalii ... GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCAReverse ... Authors Journal compilation ª 2009 FEBSand C44. This is supported by X-ray analysis of a class I chitinase from rice (Y. Kezuka, Y. Nishizawa,T. Watanabe & T. Nonaka, Nagaoka University ofTechnology,...

Báo cáo khoa học: Functional characterization of front-end desaturases from trypanosomatids depicts the ﬁrst polyunsaturated fatty acid biosynthetic pathway from a parasitic protozoan ppt

... desaturase (Fig. 5). On the other hand, the phylogenetic analysis locates L. major D4 desaturasein a subgroup with the same enzymes from trypano-somes and the microalga Pav. lutheri, and separated from ... major branch, mainly containing D6 desatu-rases from lower and higher eukaryotes and the D8desaturase from E. gracilis. It is reasonably clear from the analysis of this branch that D5 desaturases ... cruzi (EAN90580), Euglena gracilis(AAQ19605), Isochrysis galbana (AAV33631), Pavlova lutheri(AAQ98793), Thraustochytrium sp. (AAN75710), Thalassiosira pseu-donana (AAX14506); D5 desaturases from...

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

... mecha-nisms. The response curve can b e quantified by a Hillequation and is c haracterized by two p arameters, namely, the Hill coefficient and the half saturation constan t. T he Hillcoefficient is a measure ... mathemat-ical models to obtain meaningful insights. Examples of suchregulatory networks with detail ed mechanisms include the tryptophan and arabinose systems of Escherichia coli and the phage ... constraints on the candidate models. In this work,we analyze the GAL genetic switch in S. cerevisiae todemonstrate such an approach towards identifying the in vivo mechanism from a pool of candidate...

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạng Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ