0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx

Báo cáo khoa học:

Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx

... Automatically Constructing a Lexicon of Verb Phrase Idiomatic CombinationsAfsaneh FazlyDepartment of Computer ScienceUniversity of TorontoToronto, ON M5S 3H5Canadaafsaneh@cs.toronto.eduSuzanne ... can motivate a speaker to use a variantin place of a canonical form (Glucksberg, 1993).Nevertheless, lexical and syntactic flexibility maywell be used as partial indicators of semantic ana-lyzability, ... defined as phrases or sentences that involvesome degree of lexical, syntactic, and/or semanticidiosyncrasy. Idiomatic expressions, as a part of the vast fam-ily of figurative language, are widely...
  • 8
  • 295
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into the EcoRV site of ... that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing sequence simi-larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports havedemonstrated ... signalsnot as a hydrolytic enzyme but as an apparent ligandfor Patched. Proc Natl Acad Sci USA 96, 10992–10999.35 Henikoff S & Henikoff JG (1993) Performance evalua-tion of amino acid...
  • 14
  • 499
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Beyond NomBank: A Study of Implicit Arguments for Nominal Predicates" doc

... annotatedinstances. In contrast, our study focused on a se-lect group of nominal predicates, each associatedwith a large number of annotated instances.3 Data annotation and analysis3.1 Data annotationImplicit ... undergraduate assistant’s annota-tions against the evaluation data. Our assistantachieved an overall F1score of 58.4% using thesame candidate window as the baseline and dis-criminative models. ... Morristown, NJ, USA. Association for Com-putational Linguistics.Patrick Pantel and Deepak Ravichandran. 2004.Automatically labeling semantic classes. InDaniel Marcu Susan Dumais and Salim Roukos,...
  • 10
  • 402
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

... servicesthat are being developed, in all or part, and main-tained at the University of Lisbon, Department of Informatics, by the NLX-Natural Language andSpeech Group. At present, it makes available ... functionalities:• Sentence splitting• Tokenization• Nominal lemmatization• Nominal morphological analysis• Nominal inflection• Verbal lemmatization• Verbal morphological analysis• Verbal conjugation• ... service takes a Portuguese nomi-nal form — a form of a noun or an adjective, in-cluding adjectival forms of past participles –, to-gether with a bundle of inflectional feature values— values of...
  • 4
  • 299
  • 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAGVps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATCYEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGGYEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAGIRA ... Table 2. Primers used for mutagenesis.PrimerSequence(5¢-to3¢)Vps4 Upstr F CGCTGCAGTAAGAGCAGTAAACCCGVps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATTVps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAGVps4 ... Vta1p and Vps46p regulate the membraneassociation and ATPase activity of Vps4p at the yeastmultivesicular body. Proc Natl Acad Sci USA 103,6202–6207.41 Amerik AY, Nowak J, Swaminathan S &...
  • 14
  • 362
  • 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

... trehalose, turanose, raffi-nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc,pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRhaand pNPaXyl were purchased from Sigma (St. Louis, MO,USA). Galactomannans ... andsuperimposition of an equilibrium mixture of a- andb-galactose from Oryza sativa a- galactosidase [28],N-acetyl -a- galactosamine from Gallus gallus a- N-acet-ylgalactosaminidase [29] and melibiose from human a- galactosidase ... d-galactopyranose (pNPbGal), a- d-gluco-pyranose (pNPaGlc), N-acetyl a- d-glucosamine (pNPaGlcNAc), a- d-xyl opyranose (pNPaXyl), a- d-manno-pyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose...
  • 14
  • 579
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Understanding the Semantic Structure of Noun Phrase Queries" pptx

... counterparts of natural languagequestions. For example, the query “california na-tional” and “national parks califorina” both implythe question “What are the national parks in Cali-fornia?”. ... tosearch engines, such as relational databases andsemantically annotated web documents. Search-ing over such data sources, in many cases, canoffer more relevant and essential results com-pared ... Li,2009). For example, in “canon powershot sd850camera silver”, the word “canon” should be taggedas Brand. In particular, Li et al. leveraged click-through data and a database to automatically de-rive...
  • 9
  • 674
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "REFLECTIONS ON 20 YEARS OF THE ACL AN INTRODUCTION" pptx

... flow of manuscripts, and the last issue, dated 1968, was published in 1970. After a lengthy exploration of an alternative primary Journal, Dave Hays brought the American Journal of Computational ... YEARS OF THE ACL AN INTRODUCTION Donald E. Walker Artificial In~elligence Center SRI International Menlo Park, California 94025, USA Our society was founded on 13 June 1962 as the Association ... Chapln Editor (FS) Roberts Roberts Nominating Kay Kay Committee Plath Plath Members Walker Friedman Annual Meeting Atlantic City Chapel Hill 5/17 (SJCC) 7/26-27 (LSA) Program Chair Barnes...
  • 3
  • 406
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Confidence-Weighted Learning of Factored Discriminative Language Models" pptx

... confidence-weighted learning, a form of discriminative online learning that can bettertake advantage of a heavy tail of rare features.Finally, we extend the confidence-weightedlearning to deal with label noise ... represent each token by multiple factors –such as part -of- speech, lemma and surface form–and capture linguistic patterns in the target languageat the appropriate level of abstraction. Instead of estimating ... one from the shared task of the WMT-2007workshop2.Matrax, a phrase- based statistical machine trans-lation system (Simard et al., 2005), including a tri-gram generative language model with...
  • 6
  • 300
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "To wards a Self-Extending Lexicon *" doc

... involves (a) disambiguation~se|ection of the intended phrase from a set of matching phrases, (b) robust parsin~-comprehension of partially-matching phrases, and (c) error analysis use of errors ... words take and on are familiar to the learner, who also remembers the biblical story of David and Goliath. The program, modeling a language learner, interacts with a native speaker, as follows: ... novel phrases. The pro~am consists of four components: (l) Phrasal lexicon: This is a list of phrases where each phrase is a declarative pattern-concept pair [WilenskySl]. (2) Case-frame parser:...
  • 9
  • 302
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ