0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "BOTTOM-UP PARSING EXTENDING GRAMMAR CONTEXT-FREENESS PROCESSOR IN A PROCESS" potx

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

... semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and can easily ... resources into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to the system at ... Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System Lewis M. Norton, Deborah A. Dahl, Li Li, and Katharine P. Beals Unisys Corporation 2476...
  • 5
  • 416
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... and new information in formulating a paraphrase that differs in a meaningful way from the user's question. A description is also given of the transformational grammar used by the paraphraser ... used by the paraphraser to generate questions. I • INTRO~ION In a natural language interface to a database query system, a paraphraser can be used to ensure that the system has correctly understood ... represent information assumed by the questioner to be true of the database domain. This lapeling of information within the question will allow the construction of a natural paraphrase, avoiding ambiquity....
  • 6
  • 532
  • 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

... N-terminal signal peptide (amino acids1–36), we retained amino acid 36, an alanine, ratherthan using amino acid 37, a lysine, because it isknown that, after a post-translational processing of ... pre-pro-tyrosinase (Fig. S1) can be dividedapproximately into three domains: a twin argininetranslocase (TAT) signal peptide, a core domain con-taining the two copper-binding motifs and a C-termi-nal ... theirbiotechnological application.AbbreviationsL-DOPA, L-3,4-dihydroxyphenylalanine; TAT, twin arginine translocase.FEBS Journal 277 (2010) 2083–2095 ª EMPA, Swiss Federal Laboratories for Materials Testing and...
  • 13
  • 778
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot

... Balla and A. Fern. 2009. UCT for tactical assaultplanning in real-time strategy games. In 21st Interna-tional Joint Conference on Artificial Intelligence.Darse Billings, Lourdes Pe˜na Castillo, ... terrain.S S AA AA ASWhen the settlers becomes active, chose build road. A AS SS A Use settlers or engineers to improve a terrain square within the city radius A A A SA SSSSS✘✘Phalanxes are ... Monte-Carlo search. In Advances in Neural Information Processing 9, pages 1068–1074.Adam Vogel and Daniel Jurafsky. 2010. Learning tofollow navigational directions. In Proceedings of theACL, pages...
  • 10
  • 508
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Automatic Detection and Correction of Errors in Dependency Treebanks" potx

... that we basically try to repro-duce the gold standard, since parsing the data seen during the training is very easy (a similar idea in the area of POS tagging is very broadly described in ... same methodology can easily be applied to detect irregularities in any kind of annotations, e.g. labels, POS tags etc. In fact, in the area of POS tagging a similar strategy of using the same ... the fact that a lot of human post-editing and automatic quality assurance is done, errors can not be avoided completely [5]. In this paper we propose an approach for find-ing and correcting...
  • 5
  • 376
  • 0
Báo cáo khoa học: Functional analysis of disease-causing mutations in human galactokinase potx

Báo cáo khoa học: Functional analysis of disease-causing mutations in human galactokinase potx

... & Yamano, T. (2001) A genetic factor forage-related cataract: identification and characterization of a novelgalactokinase variant, ÔOsakaÕ,inAsians.Am.J.Hum.Genet.68,1036–1042.18. Ballard, ... mevalonate kinaseshows an aspartate residue at an appropriate place in theactive site to act as catalytic base [9]. However, the active siteof homoserine kinase has no residues capable of acting ... diet.Galactokinase belongs to a family of small moleculekinases, the GHMP (galactokinase, homoserine kinase,mevalonate kinase, phosphomevalonate kinase) family asdefined by sequence similarity...
  • 8
  • 414
  • 0
Báo cáo khoa học: Hansenula polymorpha pex11 cells are affected in peroxisome retention potx

Báo cáo khoa học: Hansenula polymorpha pex11 cells are affected in peroxisome retention potx

... GGGGACAACTTTGTATAATAAAGTTGGGTCGGTAGTCTAGTGGTATGEntr221_URA_F GGGGACAAGTTTGTACAAAAAAGCAGGCTGAGCTTCAACTGATGTTCAGCEntr221_URA_R GGGGACCACTTTGTACAAGAAAGCTGGGTCGAAGCACATCAACTGGATCGPEX11-del3.1 CAGACAGTTATCCAAGGTTTGCGPEX11-del3.2 ... GTGCAGATGAACTTCAGGGTCAGCTTGINP1GFP int GTACCCACACAAACAATAACGPEX11-fw ATACTGAAGCTTATGGTTTGCGACACGATAACPEX11-rev ACATTGGTCGACTCATAGCACAGAAGACTCGGAOX-detect-F CACCAGCGGATCTTCCTGGPEX11 comp-fw CGGGATCCCGTTGAACCCGATCGACAGGPEX11 ... GGGGACAACTTTGTATAGAAAAGTTGCAGACAGTTATCCAAGGTTTGCGACACGPEX11-attB1-rev GGGGACTGCTTTTTTGTACAAACTTGCGCAGCAATCCTAGCAACTTGPEX11-attB2-fw GGGGACAGCTTTCTTGTACAAAGTGGCACTAGCACGACCGAGTCTTCPEX11-attB3-rev GGGGACAACTTTGTATAATAAAGTTGGGTCGGTAGTCTAGTGGTATGEntr221_URA_F...
  • 11
  • 386
  • 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGCC3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAGHC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K ... (5¢fi3¢)MA(9)ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG6X ... GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCCT3 AATTAACCCTCACTAAAGGGB1 GCCGGGATCCTAGGGCGAATTGGGTACC864 T. Utsumi et al. (Eur. J. Biochem....
  • 12
  • 512
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "USER MODELLING, DIALOG STRUCTURE, DIALOG STRATEGY IN RAM-ANS" potx

... behavior regarding anaphora, for instance. They are processed in bypassing the normal procedure of parsing, interpretation and generating. This solution should be replaced by a dialog manager ... empirical data do support this observation (Reichman 1978). In focus is not only a certain portion of a task tree or a certain step in a plan, but also a certain view of the matter. Therefore, attached ... dialog. Man- machine-interaction is seen as formal as opposed to informal communication, and there is no way of redefining it as personal talk. The outline of the dialog is a structure at three...
  • 6
  • 311
  • 0
Báo cáo khoa học: Activity of the plant peptide aglycin in mammalian systems potx

Báo cáo khoa học: Activity of the plant peptide aglycin in mammalian systems potx

... Upward arrows indicatebeginning of injection of the extract, downward arrows indicatebeginning of washing. An aglycin interacting protein is present in the pancreatic extract.Fig. 5. ELISA ... protein molecular mass mark-ers; lane B, the aglycin binding protein isolated from mice; lane C,the aglycin binding protein isolated from pig. Staining was withCoomassie blue and numbers indicate ... opposite that of insulin, increasingrather than decreasing the blood glucose concentration.VDAC-1 was purified and identified as a specificaglycin binding protein. A high-affinity protein bindingsite...
  • 9
  • 433
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP