0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

... Structure activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity Alexei N. Veselkov1, Vladimir Ya. Maleev2, ... width at half height) of the heat absorptioncurve. All values of thermodynamic parameters werecalculated for 1 mol base pairs, taking an average molecularmass of a DNA base pair as 660 Da.ResultsDose-dependent ... struc-ture activity relation. Keywords: apoptotic activity; differential scanning calori-metry (DSC); drug DNA binding; phenoxazone drugs; structure activity relationship.Many anti-tumour drugs are...
  • 8
  • 331
  • 0
Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

... of an arginine residue atposition 12 (Table 1) appears to contribute to a4 b2anda7subtype activity but not a3 b2 activity. A decrease in a4 b2 and a7 subtype activity but not a3 b2 activity was ... Mutational analyses havealso been valuable in elucidating factors important for activity. Table 2 lists the most informative mutations thathave been made in a range of a- conotoxins. In addition,an ... Queensland, Brisbane, QLD, Australia a- Conotoxins that target the neuronal nicotinic acetylcho-line receptor have a range of potential therapeutic applica-tions and are valuable probes for examining...
  • 7
  • 492
  • 0
Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx

Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx

... that retainsthe antibacterial potency but which has substantiallyreduced cytotoxicity. Such a peptide analog may rep-resent an excellent candidate as a novel antimicrobialagent against bacteria ... fowlicidin-1 and its analogsTwo representative Gram-negative bacteria (Escher-ichia coli ATCC 25922 and Salmonella enterica serovarTyphimurium ATCC 14028) and two Gram-positivebacteria (Listeria monocytogenes ... 94,672–682.9 Nagaoka I, Hirota S, Yomogida S, Ohwada A & HirataM (2000) Synergistic actions of antibacterial neutrophildefensins and cathelicidins. Inflamm Res 49, 73–79.10 Tossi A, Sandri L &...
  • 13
  • 386
  • 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

... described here and is present in theS. agalactiae PPase, kinase and adenylosuccinate syn-thase, but not in S. agalactiae CovR ⁄ CsrR. The motifis located at the surface of the SaPPase (Rantanen,unpublished), ... mechanisms inStreptococcus agalactiae. Mol Microbiol 62, 941–957.23 Rantanen MK, Lehtio¨L, Rajagopal L, Rubens CE &Goldman A (2006) Crystallization and preliminary crys-tallographic analysis ... fused to an EF-hand motif, and human STP(HsSTP), which has an additional 8 kDa a- helicaldomain at the C-terminus [3,4].The sizes of the catalytic domains of both PPP and PPM families are well...
  • 10
  • 542
  • 0
Báo cáo khoa học: D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH ppt

Báo cáo khoa học: D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH ppt

... themutant proteins were as follows (mutated sites are under-lined): D8 8A, 5¢-ACATTTGTCGCCATGGATCC-3¢;D88V, 5¢-GCCGACATTTGTCGTCATGGATCC-3¢;D88N, 5¢-GCCGACATTTGTCAACATGGATCC-3¢; and D39 3A, 5¢-CTGAACCGAGCTGTCGGAAT-3¢.The ... in absorbance (DA) at 413 nm from that at395 nm caused by Cl– binding. Analytical methodsThe Nor activity of P450nor was assayed as reported [4].P450nor (6 nM) was incubated anaerobically ... cluster is important for releasing NAD+, leading to a charge balance in the accesschannel. This charge balance would b e important for both binding to NADH and release of NAD+.It is evident...
  • 8
  • 405
  • 0
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot

... FEBSAsp110Asp185Asp186Trp229Tyr181NNRTIbpETyr188Asp110Asp185Asp186Trp229Cys181NNRTIbpBAsp110Asp185Asp186Trp229Tyr181NNRTIbpTyr188FAsp110Asp185Asp186Trp229Cys181NNRTIbpCAsp110Asp185Asp186Trp229Tyr181Tyr188NNRTIbpGTyr188Tyr181Trp229Asn103DAsp110Asp185Asp186Trp229Tyr181Tyr188NNRTIbpHAsp110Asp185Asp186Trp229Cys181NNRTIbp A K126K126IAsp110Asp185Asp186Tyr181Trp229Asn103K126K54K54KNA53KNA53K49K49VAL10 8A VAL10 6A PHE22 7A LEU23 4A TRP22 9A TYR18 8A TYR31 8A LEU10 0A TYR18 1A VAL10 8A TRP22 9A LEU23 4A PHE22 7A PRO23 6A TYR18 8A VAL10 6A LEU23 4A PHE22 7A VAL10 8A TYR18 8A TYR18 3A TRP22 9A LEU10 0A LEU10 0A TYR31 8A TYR18 8A TRP22 9A LEU23 4A ASN10 3A VAL10 6A VAL10 8A TYR18 8A VAL10 8A TYR18 8A MET23 0A LEU23 4A TRP22 9A VAL10 8A LEU22 8A TRP22 9A LEU10 0A TYR18 8A TYR18 8A VAL10 6A VAL10 8A PHE22 7A TYR31 8A LEU23 4A LEU10 0A VAL10 8A PHE22 7A TYR18 8A LEU23 4A LEU10 0A TYR31 8A VAL10 6A OOOOOOOOOOOOBrOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOPrOFig. ... FEBSAsp110Asp185Asp186Trp229Tyr181NNRTIbpETyr188Asp110Asp185Asp186Trp229Cys181NNRTIbpBAsp110Asp185Asp186Trp229Tyr181NNRTIbpTyr188FAsp110Asp185Asp186Trp229Cys181NNRTIbpCAsp110Asp185Asp186Trp229Tyr181Tyr188NNRTIbpGTyr188Tyr181Trp229Asn103DAsp110Asp185Asp186Trp229Tyr181Tyr188NNRTIbpHAsp110Asp185Asp186Trp229Cys181NNRTIbp A K126K126IAsp110Asp185Asp186Tyr181Trp229Asn103K126K54K54KNA53KNA53K49K49VAL10 8A VAL10 6A PHE22 7A LEU23 4A TRP22 9A TYR18 8A TYR31 8A LEU10 0A TYR18 1A VAL10 8A TRP22 9A LEU23 4A PHE22 7A PRO23 6A TYR18 8A VAL10 6A LEU23 4A PHE22 7A VAL10 8A TYR18 8A TYR18 3A TRP22 9A LEU10 0A LEU10 0A TYR31 8A TYR18 8A TRP22 9A LEU23 4A ASN10 3A VAL10 6A VAL10 8A TYR18 8A VAL10 8A TYR18 8A MET23 0A LEU23 4A TRP22 9A VAL10 8A LEU22 8A TRP22 9A LEU10 0A TYR18 8A TYR18 8A VAL10 6A VAL10 8A PHE22 7A TYR31 8A LEU23 4A LEU10 0A VAL10 8A PHE22 7A TYR18 8A LEU23 4A LEU10 0A TYR31 8A VAL10 6A OOOOOOOOOOOOBrOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOPrOFig. ... transcriptase (RT) has two associated activities, DNA poly-merase and RNase H, both essential for viral replication and validated drugtargets. Although all RT inhibitors approved for therapy...
  • 14
  • 425
  • 0
Báo cáo khoa học: The activity of Plasmodium falciparum arginase is mediated by a novel inter-monomer salt-bridge between Glu295–Arg404 doc

Báo cáo khoa học: The activity of Plasmodium falciparum arginase is mediated by a novel inter-monomer salt-bridge between Glu295–Arg404 doc

... bacterial and mammalian templates.P. falciparum Glu295 aligns with an Asp in mam-mals (human arginase II: Asp223; rat arginase I:Asp204), fungi and bacteria (B. caldovelox arginase:Asp199). ... indicated that P. falciparum arginase has a strong depen-dency between trimer formation, enzyme activity and metal co-ordination.Mutations that abolished Mn2+ binding also caused dissociation ... mutations that abolished trimer formation resultedin inactive monomers. By contrast, the monomers of mammalian (and therefore host) arginase are also active. P. falciparum arginase thus appearsto...
  • 14
  • 425
  • 0
Báo cáo khóa học: UDP-galactose 4-epimerase from Kluyveromyces fragilis Evidence for independent mutarotation site pdf

Báo cáo khóa học: UDP-galactose 4-epimerase from Kluyveromyces fragilis Evidence for independent mutarotation site pdf

... re-activation ratewas observed in all cases. Relative re-activation rates and maximum recoveries were as follows: 1.1 and 82% for yeastmutarotase, 3.2 and 88% for epimerase, and 6.8 and 91% for capsicum ... optima of mutarotase from both kidney cortex and capsicum are broad, with maxima at % 7.4, and activity atpH 4.0 and 8.0 was 70–72%. For yeast mutarotase, the pHoptimum was 7.5, with 60–70% of activity ... from bacteria tomammals, its quaternary structure, size and NAD require-ment vary. The bacterial and yeast enzymes are homo-dimers with bound NAD, whereas, mammalian enzymesare monomeric and...
  • 11
  • 362
  • 0
Báo cáo khoa học: K182G substitution in DevR or C8G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis doc

Báo cáo khoa học: K182G substitution in DevR or C8G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis doc

... CGACACGTAGTTCGCCACCGTCTTTTCfdxA-C8G f TGACGAATAAGGCGTTTGGTCCTTTCCfdxA-C8G r GGAAAGGACCAAACGCCTTATTCGTCAfdxA -A9 T f TGACGAATAAGGCCATTGGTCCTTTCCfdxA -A9 T r GGAAAGGACCAATGGCCTTATTCGTCAfdxA-C8G -A9 T f TGACGAATAAGGCGATTGGTCCTTTCCfdxA-C8G -A9 T ... TGACGGGCTATCGTAAGTTTATGfdxA r CACGCACTCACTACCGATCACAK182G f GAAAAGACGGTGGGGAACTACGTGTCGK182G r CGACACGTAGTTCCCCACCGTCTTTTCK18 2A f GAAAAGACGGTGGCGAACTACGTGTCGK18 2A r CGACACGTAGTTCGCCACCGTCTTTTCfdxA-C8G ... mutation inthe Dev box impairs protein DNA interaction and abrogates DevR-mediated gene induction inMycobacterium tuberculosisRajesh Kumar Gupta, Santosh Chauhan* and Jaya Sivaswami TyagiDepartment...
  • 9
  • 351
  • 0
Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

... times.Analytical HPAECThe deacylated LPS was analysed by analytical high-performance anion exchange chromatography (HPAEC)on a column of CarboPak PA1 (4 mm · 250 mm, Dionex)using the eluents (A) ... metallicsample holder, dried in a stream of air and analyzedimmediately after evaporation. The spectra are the sum of atleast 50 single laser shot experiments. External mass scalecalibration ... [8]. Analytical data haveshown that the fatty acids in LPS of Chlamydiae have acylchains with up to 22 carbon atoms and also that 3-hydroxyfatty acids occur only with amide-linkage [9,10]....
  • 11
  • 560
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ