Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferﬁsh (Tetraodon ﬂuviatilis) ppt

... TGG AAC GAC GG gtaagggaac 172 ttttttttag A GCC ATA CTG Gly593 (2)15 143 AAC AAA GCA G gtatattcag 434 atgtttccag GT GAG AGA ATG Gly640 (1)16 156 CCG CCC CTT T gtaagcaacc 139 tcacctaaag CC AAA ... ttttctacag C ACC TTT ATT Ser331 (2)9 80 AAC ACA AGG AA gtaagttcaa 535 tctgccacag T GAA AGC AGT Ans391 (2)10 88 TTC AGG AAC ATG gtgagtgcct 306 atccttgtag TCC TTG AAG Met420 (3)11 123 TTT CAA GTG ... CTG TCC Ala184 (1)6 131 AAA TAC CGA CTG gtaaacccaa 79 atgataccag GAC CTG GCA Leu227 (3)7 152 CTG CAG TCA TG gtgagttgtc 231 tgcataacag G TGT GAG AAG Trp278 (2)8 156 CTG GTT ACC AG gtatctgcct...

Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulﬁde isomerase from Conus marmoreus pdf

... Subsequently,insulin was added, and a stable nonenzymatic rate wasrecorded. Finally, PDI was added, and the total NADPHoxidation rate was recorded.The oxidase and isomerase activities of PDI were mea-sured ... reaction times, the refoldingmixture was acidiﬁed and immediately analyzed by RP-HPLC. The amounts of native and linear tx 3a were calculated from their elution peakareas. The data are the average ... maturecPDI protein has a calculated molecular mass of 54 913.7 Da and an isoelectric point of 4.6. The cPDIcontains four thioredoxin domains and an acidic C-ter-minal tail (a, b, b¢, a and...

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

... min at 72 °Cwith a 5 min preheat at 95 °C and a 10 min final extensionat 72 °C using primers, S1 (5¢-GCAAATGCAACTGGAAGCGG-3¢)andA1(5¢-ACAGCCTGCTAGCAAAGAGG-3¢) for amplification of HRT1, and ... Wititsuwannakul4,Seiji Takahashi1, Atiya Rattanapittayaporn4 and Tanetoshi Koyama11Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai, Japan;2Department of Chemistry,Thaksin ... primers S2(5¢-GAAGAATCCTCTAAGGATAA-3¢)andA2(5¢-TACAAGGATTAATCCCTTGC-3¢) for amplification of HRT2. The PCR products were analyzed by agarose gelelectrophoresis with ethidium bromide staining.Construction...

Báo cáo khoa học: Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, fromCoturnix coturnix pdf

... MEGFFWKTLLVVGALAIAGTSSLPH.KPLIYEEAVDLAVSIYNSKSGEDS.LYRLLEAVSPPKWD.PLSESLLLLLLLLLLLLLLLLLLLLLLLYYYYYYYYYYYYYYYYYYYYYYY A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A ANNNNNNNNNNNNNNNNNNNNNNNRRRRRRRRRRRRRRRRRRRRRRRLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL ... TC-CTA TCA-C-T-GCCG T-G CA-G-T 457Cc-CATH3 CAT AAA C G ATGA acg-t c 480Cc-CATH1 actgtcccctcgctgccttccatccaataaaggtctttgctggtaaaaaaaaaaaaaaaa 531Cc-CATH2 TTG-CTGAg-gaataaa-ggggc gtgtg c-accaagc -a ... c-accaagc -a 517Cc-CATH3 g tc a cc c aataaa-c-g ttca-gct 540C c- CATH 1 aa a a aa a a aa aa a a 5 45C c -C AT H 2 - - - - 5 31C c -C AT H 3 - - - - a 55 5Fig. 1. Alignment of the cDNA sequencesof...

Báo cáo khóa học: Localization, puriﬁcation and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot

... Localization, puriﬁcation and properties of a tetrathionate hydrolase from Acidithiobacillus caldusZhanna Bugaytsova* and E. Bo¨ rje Lindstro¨mDepartment of Molecular Biology, Umea˚University, ... interference of ammonium sulfate with the HPLC-assay of tetrathionate was also tested. The height of thetetrathionate peak decreased and a shoulder appeared in theHPLC-chromatograms as the ammonium ... cell fractions. Distribution and activity of assayed enzymes are given as a percentage of the total protein concentration and total activity in the cell free extract. Tetrathionate hydrolase activity...

Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

... (5¢fi3¢)FLAG epitope GAC TAC AAG GAT GAC GAT GAT AAGDYKDDDDKLibrary template(FLAG-negative)TTG GGG CTG GAT GAC GCG GAT AAGL GLDDADKRandomization NNS NNS NNS GAT GAC NNS GAT AAGXXXDDXDKSelected ... proteins carrying a functionalFLAG epitope from an excess of FLAG-negative com-petitors and from a large library of random variantswas also undertaken by plasmid display, to confirmthe efficacy of ... underlying (ba)8-barrel. This was inves-tigated by comparing the far-UV and near-UV CDspectra of PRAI and FLAG-PRAI in a buffer inwhich PRAI retains catalytic activity (Fig. 3). Thespectra are effectively...

Báo cáo khoa học: Neuropeptide Y expression and function during osteoblast differentiation – insights from transthyretin knockout mice potx

... 5¢-GTGGGCCGCTCTAGGCACCAA-3¢ and 5¢-CTCTTTGATGTCACGCACGATTTC-3¢; for HPRT, 5¢-GTAATGATCAGTCAACGGGGGAC-3¢ and 5¢-CCAGCAAGCTTGCAACCTTAACCA-3¢; for GAPDH, 5¢-ACTCCACTCACGGCAAATTC-3¢ and 5¢-CCTTCCACAATGCCAAAGTT-3¢; ... 5¢-TCTGATGAGACCGTCACTGC-3¢ and 5¢-TCTCCTGGCTCTCTTTGGAA-3¢; for PAM, 5¢-CCTGGGGTCACACCTAAAGA-3¢ and 5¢-TGTAAGGACACACCGGAACA-3¢; for Y1 receptor, 5¢-CTCGCTGGTTCTCATCGCTGTGGAACGG-3¢ and 5¢-GCGAATGTATATCTTGAAGTAG-3¢ ... 5¢-CCTTCCACAATGCCAAAGTT-3¢; for NPY, 5¢-TGGACTGACCCTCGCTCTAT-3¢ and 5¢-GATGAGGGTGGAAACTTGGA-3¢; forosteocalcin, 5¢-CTCTGTCTCTCTGACCTCACAG-3¢ and 5¢-CAGGTCCTAAATAGTGATACCG-3¢ [44]; for osteopontin, 5¢-TCTGATGAGACCGTCACTGC-3¢...

Tài liệu Báo cáo khoa học: Identiﬁcation, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723RpCAbrR3 ... 706–723RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483Probe ampliﬁcation for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C ... sequenced RpCAtr (BPNJ¼ 100 and BPMP¼ 99). Fungia scutaria (FCA -a and FCA-b) and Caenorhabditis elegans (CA1 and CA2) sequences falloutside of clade I and are more closely related to eachother...

Báo cáo khoa học: Identiﬁcation, cloning and characterization of two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, from the barley seed proteome pot

... I-D-AEA-K R-DD-QNTIVK-VGATAASASA 122 A Active siteR101BNRI/MHvTrxh1HvTrxh2Ta a Os a OsbTdTabTacTadHv a ScLpHbOscCKN A ZmOseOsdLcPcAtaAtbAtcAtdAteAtfAtgBnaBoBnbBraBrbPmFeCmNtaPtAthAtiRcNtbNtcPpPsaPsbPscPsd*Fig. ... puriﬁedprotein was missing methionine and alanine from theN-terminus. This was conﬁrmed by the N-terminalsequences of HvTrxh2, determined to be AASATAAAVA and ASATAAAVAA. Multiple peaks were observed ... with an approximate molecular mass of 12 kDa and pI 5.0 (Fig. 1A) .Protein spots excised from a colloidal Coomassie-stainedgel of mature barley seed proteins were digested with trypsin and analysed...

Báo cáo khoa học: Coexpression, puriﬁcation and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

... GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA33 CCGGAATTCTTATTTCCCTTCTCTCATCTC40 GCGCGCCATGGAAAAAGATCTACAGTTAAGA41 GGGGGATCCCCATAATCCACTCCACCTGCTAAA44 GGGGGGGATCCT CATTATTTCCCTTCT66 AATACCGCCATGTATAATATCTATTACTTC67 ... AATACCGCCATGTATAATATCTATTACTTC67 GTAATAGATATTATACATGGCGGTATTGAA75 GGGGGGGCCATGGAAAGAGCAGACGATTT4294 H P. Chen et al.(Eur. J. Biochem. 271) Ó FEBS 2004assay k it was obtained f rom B io-Rad, H ercules, CA, USA. A ... enzymes, and Ex Taq DNA polymerasewere purchased from TaKaRa (Otsu, Japan). The E. colistrain BL21(DE3) codon plus was from Stratagene.1,4-Diaminobutane and (R,S)-2,4-diamino-n-butyric acidwere from...

Xem thêm