0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term Extraction" pot

Báo cáo khoa học:

Báo cáo khoa học: "You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) A Qualitative Evaluation of Association Measures for Collocation and Term Extraction" pot

... Linguistics You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) A Qualitative Evaluation of Association Measures for Collocation and Term ExtractionJoachim Wermter Udo HahnJena University Language ... Chapter of the Association for Com-putational Linguistics, pages 18 8–1 95. Toulouse,France, July 9-11, 2001. San Francisco, CA: Mor-gan Kaufmann.Katerina T. Frantzi, Sophia Ananiadou, and HidekiMima. ... The Balancing Act: Combining Statistical and Symbolic Approaches to Language, pages 4 9– 66. Cambridge, MA: MIT Press.Stefan Evert and Brigitte Krenn. 2001. Methods for the qualitative evaluation...
  • 8
  • 435
  • 0
Tài liệu Báo cáo khoa học: KCNE4 can co-associate with the IKs (KCNQ1–KCNE1) channel complex ppt

Tài liệu Báo cáo khoa học: KCNE4 can co-associate with the IKs (KCNQ1–KCNE1) channel complex ppt

... understanding of the role of KCNE4 as a potentially important regulator of KCNQ1 and otherKVchannels.ResultsCharacterization of KCNE4 antibody A rabbit polyclonal antibody raised against a C-termi-nal ... inactivation behaviour of voltage-gated K-channels may be determined by association of alpha- and beta-subunits. J Physiol Paris88, 17 3–1 80.Supplementary materialThe following supplementary ... & Greger R (1999) Carbachol activates a K+channel of very small conductance in the basolater-al membrane of rat pancreatic acinar cells. PflugersArch 438, 59 7–6 03.34 Bleich M & Warth...
  • 14
  • 486
  • 0
Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx

Báo cáo khoa học: Nanoparticles can induce changes in the intracellular metabolism of lipids without compromising cellular viability docx

... assays would expand the current platform of tests for thedetermination of the biocompatibility of nanomaterials.AbbreviationsDIV 8, day (in vitro) 8; FAS, fatty acid synthase; FFA, free fatty ... (Burlington,Canada); Oil Red O, Harris hematoxylin, polyornithine and laminine from Sigma (Oakville, Canada); formalinfrom Fisher Scientific (Nepean, Canada); Alamar bluereagent from Biosource (Montreal, ... Pathogenesis of lipodystrophy and lipid abnormalities in patients taking antiretroviraltherapy. AIDS Rev 9, 3–1 5.22 Li J, Bosch-Marce M, Nanayakkara A, Savransky V,Fried SK, Semenza GL &...
  • 14
  • 540
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The Benefit of Stochastic PP Attachment to a Rule-Based Parser" doc

... existence of learnt and handwritten grammars of natural languages. A great many formalisms have been advanced thatfall into either of the two variants, but even thebest of them cannot be said to ... guidethe parser when it has no other means of makingan attachment decision. Finally, the parser and grammar are freely available for use and modi-fication (http://nats-www.informatik.uni-hamburg.de/download).Weighted ... can make to the per-formance of a full parser for unrestricted text.The accuracy of PP attachment has rarely beenevaluated as a subtask of full parsing. (Merlo et al.,1997) evaluate the attachment...
  • 8
  • 331
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "EM Can Find Pretty Good HMM POS-Taggers (When Given a Good Start)∗" docx

... (and a morphological analyzer), and a fair amount of unlabeled training data, but hardlyany annotated corpora. We actually report resultson full morphological disambiguation for Hebrew, a task ... estimate the probability of a taggiven a context as the average probability of a taggiven any of the words appearing in that context, and similarly the probability of a tag given a word is theaveraged ... tag-word annotations). This small seedinitialization (InitTrans) has a great impact on ac-curacy. Overall, we reach 89.4% accuracy on fullmorphological and 92.4% accuracy for POS tagging and word...
  • 9
  • 364
  • 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... mutants and GAL4-GRASP55revealed that, apart from the VP16-MT1 FFR(Fig. 5A, lane 3) and VP16-MT1 DKV mutants(Fig. 5A, lane 9), all the other triple mutants (Fig. 5A, lanes 4–8 ) displayed a marked ... Beznoussenko G,Savarese M, Marra P, Di Tullio G, Martire G, DeMatteis MA & Bonatti S (2009) GRASP65 and GRASP55 sequentially promote the transport of C-terminal valine-bearing cargos to and through ... Intracellular activation of gelatinase A (72-kDa type IV collagenase) by normal fibroblasts.Proc Natl Acad Sci USA 94, 442 4–4 429.60 Deryugina EI, Ratnikov BI, Yu Q, Baciu PC, RozanovDV &...
  • 18
  • 603
  • 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... N-terminalhexahistidine tag was obtained by PCR using thepET2 1a ⁄ PNT-H6plasmid [30] as the template. The forwardprimer (5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATGC-3¢) was designed to insert a ClaI ... N-terminus was obtained by PCR from theplasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag ... Spectra at 20 °C weremeasured in the range 18 5–2 60 nm for far-UV measures, 26 0–4 00 nm for near-UV measures and 40 0–7 50 nm for UV-visible measures, with 0.2 nm data pitch and 20 nmÆmin)1scanning...
  • 14
  • 672
  • 0
Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc

Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc

... NirE_Compl _for (GAGAATTCGGAAATCGGCCTCG) and NirE_Compl_rev (CTAAGCTTTCAGGCGCATGCG) for the nirE gene and CobA_Compl _for (GAGAATTCACTGCTGGCGGCC) and CobA_Compl_rev (CTAAGCTTTCAGGCGCTCAGGG) for ... recombinant NirE from Pseu-domonas aeruginosa and characterization of in vivo accumulatedtetrapyrroles. (A) SDS ⁄ PAGE analysis of the production and purifi-cation of recombinant NirE. Lane 1, ... lm) and HemD (0.17 lm). Alternatively, uroporphyrin III wasreduced chemically and used at a final concentration of 8 lm. The reaction was started by the addition of SAM to a final concentration of...
  • 10
  • 539
  • 0
Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx

Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx

... tRNASer:SerRScomplexes (lanes 1 and 5, respectively) have a pI value of approximately 5.2.Dimerization of archaeal tRNA transcriptUnlike many other tRNAs, M. maripaludis and M. janna-schii tRNASerGCUtranscripts ... mMMgCl2before placing on ice. The amount of active tRNAwas determined by measuring aminoacylation plateau withhomologous SerRSs (at 37 °CforM. maripaludis and 55 °CforM. jannaschii). The acceptor activities ... heat denaturation of E. coli proteinswas performed, and after separation of M. jannaschi His-tagged SerRS by Ni–NTA affinity chromatography, basicSerRS protein was additionally purified on a...
  • 9
  • 341
  • 0
Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx

... extracts were analy zed by H PAEC-PAD. As a standard, a commercial maltodextrin sample (Dextrin 15, Fluka, Germany) wasused. Data f rom a single e xperiment are shown. The maltod extrinpatterns ... U25436) 5¢-ATGGCCAAGAAAGTTGCCATCTGT; 3¢-TCAGGTATCAGGCTTTGGGAATGC. RT-PCR was performed using SSII R NaseH RT (Invitrogen,Karlsruhe, Germany) and High Fidelity Expand Poly-merase (Roche, Mannheim, ... i.e. a mass of 28 Da. All y-type fragments contain theC-terminus of the p eptide. Many fragments show a satellitepeak at )17 Da. This peak is due to a loss of NH3,presumably from an asparagine...
  • 12
  • 513
  • 0

Xem thêm

Từ khóa: tỷ lệ cán bộ y tế đi tham dự các hội thảo báo cáo khoa học về thuốc và sử dụng thuốcbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ