0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "How Many Words is a Picture Worth? Automatic Caption Generation for News Images" docx

Báo cáo khoa học:

Báo cáo khoa học: "How Many Words is a Picture Worth? Automatic Caption Generation for News Images" docx

... insummarization which is solely text-based.3 Problem FormulationWe formulate image caption generation as fol-lows. Given an image I, and a related knowl-edge database κ, create a natural language descrip-tion ... mlap@inf.ed.ac.ukAbstractIn this paper we tackle the problem of au-tomatic caption generation for news im-ages. Our approach leverages the vast re-source of pictures available on the weband ... Instead of relyingon manual annotation or background ontologicalinformation we exploit a multimodal database of news articles, images, and their captions. The lat-ter is admittedly noisy,...
  • 11
  • 464
  • 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... was for 5 days. (C) Heart, kidney, lung and spleen RNA from each of three animals was analysed for Cyp4x1 RNA, and a 5-day exposure of the autoradiograph is shown; – and + represent yeast tRNA ... recep-tor-alpha expression in human liver. Mol Pharmacol 53,14–22.35 Akiyama TE et al. (2001) Peroxisome proliferator-acti-vated receptor-alpha regulates lipid homeostasis, but is not associated with ... physiological function [11–16].Cytochrome P450 metabolism of fatty acids may alsobe of fundamental importance in brain [17–19], and it is known that neurotransmitters and fatty acids can beactively...
  • 12
  • 466
  • 0
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx

... fluorescent ac band was observed. Thiswas surprising because the ATP analogue AMP-PNP is known to stabilize F1complexes and was added tocrystallization media in X-ray structure analysis [9,35–38].To ... cR252 andcT253 made more than one turnover around w-angle.In both cases the m olecular dynamics simulations revealedthat rotation around the w Ramachandran angle w aspreferred over that around ... synthase of bacteria, chloroplasts, and mito-chondria catalyses the endergonic synthesis of adenosinetriphosphate (ATP) from adenosine d iphosphate (ADP)and phosphate (Pi) using a transmembrane...
  • 9
  • 546
  • 0
Báo cáo khoa học: Mouse RS21-C6 is a mammalian 2¢-deoxycytidine 5¢-triphosphate pyrophosphohydrolase that prefers 5-iodocytosine pdf

Báo cáo khoa học: Mouse RS21-C6 is a mammalian 2¢-deoxycytidine 5¢-triphosphate pyrophosphohydrolase that prefers 5-iodocytosine pdf

... methylation. Proc Natl Acad SciUSA 95, 8727–8732.37 Matsumoto M, Hatakeyama S, Oyamada K, Oda Y,Nishimura T & Nakayama KI (2005) Large-scale analy-sis of the human ubiquitin-related proteome. ... HisIE, Saccharomyces cerevisiaeHIS4, Arabidopsis thaliana HisIE), or the MazG family(SSO12199, E. coli MazG, Thermotoga maritimeMazG, Bacillus subtilis YABN, Streptomyces cacaoiYBL1). Because ... A trans-halogenation pathway for generating mutagenicnucleobases during inflammation. J Biol Chem 276,7867–7875.30 Kawai Y, Morinaga H, Kondo H, Miyoshi N,Nakamura Y, Uchida K & Osawa...
  • 13
  • 424
  • 0
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf

Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf

... GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCCF: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCACDLfdel.RRS: CTAGTGTCTGATGCTGCAACCACCGCCACF: GTGGCGGTGGTTGCAGCATCAGACACTAGDLfdel.KKS: ... GTGTGGCAGGACGCTGCGCCTTTCACAGF: CTGTGAAAGGCGCAGCGTCCTGCCACACEMSAS¢1Skp1S: TCCCAGAGGCACTGTACATCTCTGF: CAGAGATGTACAGTGCCTCTGGGAS¢2Skp1S: GCCTCTTTAGAAGTCAATAGTAGGF: CCTACTATTGACTTCTAAAGAGGCS2 ... GCCTCTTTAGAAGATCAAAAGTAGGF: CTACTTTTGATCTTCTAAAGAGGCNS* S: TGGAGCCATCTCTCAGACTTGGGF: CCCAAGTCTAGAGAGATGGCTCCADelta-lactoferrin enhances Skp1 gene transcription C. Mariller et al.2048 FEBS Journal...
  • 16
  • 363
  • 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

... Immunoreactivebands were visualized using an ECL kit (AmershamBiotech).Results are expressed as means ± SEM for the numberof hepatocyte preparations indicated. Statistical analysiswas by Student’s ... inactivation ofphosphorylase is associated with both activation andtranslocation of glycogen synthase, and that the formermechanism alone cannot explain the stimulation of glyco-gen synthesis. ... synthesis and glycogen synthaseactivity, with a basal rate of flux at or near the plateau.The phosphorylase inactivator, CP-91149, caused bothactivation of glycogen synthase and translocation of...
  • 9
  • 381
  • 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... this domain was found insome closely related bacterial species, but mainly innonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase (listed in Table S1),as ... charges are observed in five linkers(Daphnia Amy1, Capitella, Petrolisthes, Patella andLottia). In folded proteins, an ion pair between adja-cent acidic and basic side chains is unlikely as a ... fluminea as a query, sequence databases were searched by blastp andtblastn for the occurrence of domains similar to theP. haloplanktis C-terminal domain. URLs of the relevantgenome databases are...
  • 8
  • 624
  • 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... N-terminus was obtained by PCR from theplasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TACCTGGCCAATGAATATGCATCATCATCATCATCATACTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ... N-terminalhexahistidine tag was obtained by PCR using thepET2 1a ⁄ PNT-H6plasmid [30] as the template. The forwardprimer (5¢-TACCGTTAACATCGATATGCATCATCATCATCATCATGC-3¢) was designed to insert a ClaI ... the EXTRAprogramme of UNIMIB-Cariplo, allowing her to carryout part of this work in Marseille. The authors wish tothank Antonino Natalello and Silvia Maria Doglia for their assistance with...
  • 14
  • 672
  • 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx

... (Molecular Probes, Carlsbad, CA, USA) and horseradishperoxidase (HRP) coupled goat anti-mouse and goat anti-rabbit IgGs (Bio-Rad, Hercules, CA, USA).Cell culture and transfectionAll tissue ... informationThe following supplementary material is available:Table S1. Peptide microarray.This supplementary material can be found in theonline version of this article.Please note: As a ... 567–580.35 Katada S, Hirokawa T, Oka Y, Suwa M & TouharaK (2005) Structural basis for a broad but selectiveligand spectrum of a mouse olfactory receptor: map-ping the odorant-binding site....
  • 12
  • 543
  • 0
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

... Kanto T, Hayashi N, Takehara T, Hagiwara H, MitaE, Naito M, Kasahara A, Fusamoto H & Kamada T(1994) Buoyant density of hepatitis C virus recoveredfrom infected hosts: two different features ... proteaseand its cofactor NS 4A. In addition to the N-terminalprotease domain, the carboxy-terminal domain of NS3consists of an RNA helicase and NTPase activity.NS 4A serves as a cofactor for ... (2005) Hepatitis C virus particles and lipo-protein metabolism. Semin Liver Dis 25, 93–104.15 Kaito M, Watanabe S, Tsukiyama-Kohara K, Yamagu-chi K, Kobayashi Y, Konishi M, Yokoi M, Ishida S,Suzuki...
  • 15
  • 570
  • 0

Xem thêm

Từ khóa: many words is a picture worthwords is a picture worthbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ