Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

... during adipogenesis FEBS Journal 272 (2005) 1590–1599 ª 2005 FEBS 1599 SLC3 9A1 4, a LZT protein, is induced in adipogenesis and transports zinc Kei Tominaga1,2, Takeshi Kagata1, Yoshikazu ... Ltd), a SLC3 9A1 4-specific forward primer:5¢-CCCACTCAGTAGCTGTGT-3¢,5¢-CAATGCTGGCATGAGCAT-3¢ or 5¢-CTTCTTGGGGAAACATG-3¢, and a reverse primer: 5¢-CCAGCATAATGGAGAAGC-3¢,5¢-AACTGGACCCTAAGCCTA-3¢ ... functions of SLA3 9A1 4 in adipo-cyte differentiation is definitely needed. Zinc is an essential metal in all eukaryotes. Zinc transporting proteins were first reported in yeast and plants. In mammals, the...

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... TCTCGAAGATATGACTCCAGGACCACAATATTTTCT135mC9.R: GGCTTCCATGGCATACTCCACARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC706mCARP.R: TGGCACTGATTTTGGCTCCTE2-14 ... TCACAGGACACTGAGCAATGGCTGATC1691p21.R: GTGCTTTGACACCCACGGTAUb Ubiquitin X51703 22mUbiq.F: TCGGCGGTCTTTCTGTGAG51mUbiq.P: TGTTTCGACGCGCTGGGCG96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAACardiac ankyrin ... CAACAACCCAGAGAGCTGCTCCGTCTC1353mMafBx.R, TGTTGTCGTGTGCTGGGATTMLC-f Myosin light chain, fast BC055869 396mMLCfast.F: TGGAGGAGCTGCTTACCACG423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA500mMLCfast.R:...

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

... Sharma1, Meetu Gupta1, Ananth Krupa2,*, Narayanaswamy Srinivasan2 and Yogendra Singh11 Institute of Genomics and Integrative Biology, Delhi, India2 Molecular Biophysics Unit, Indian Institute ... protein phosphatase, a phosphoprotein-binding domain. Proc Natl Acad SciUSA 96, 7821–7826.32 Chopra P, Singh A, Koul A, Ramachandran S, DrlicaK, Tyagi AK & Singh Y (2003) Cytotoxic activity ... characteriza-tion and localization. Microbiology 147, 2307–2314.12 Gopalaswamy R, Narayanan PR & Narayanan S (2004)Cloning, overexpression, and characterization of a serine ⁄ threonine...

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... recognition. In recent years, a number of studies have inves-tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... Naive Bayes, SVMDavidov et al. 2010 n-grams, word patterns, punctuation information k-Nearest NeighborBermingham and Smeaton 2010 n-grams and POS tags Binary Classifica-tion 33guage...

Tài liệu Báo cáo khoa học: "Archivus: A multimodal system for multimedia meeting browsing and retrieval" doc

... meeting browsing and retrievalMarita Ailomaa, Miroslav Melichar,Martin RajmanArtificial Intelligence LaboratoryÉcole Polytechnique Fédérale de LausanneCH-1015 Lausanne, Switzerlandmarita.ailomaa@epfl.chAgnes ... considered and controlledfor in the experiment increases substantially. Forinstance, if it is the case that within a single inter-face any task that can be performed using naturallanguage can also ... http://www.icsi.berkeley.edu/Speech/EARS/rt.htmltry out and consistently use novel input modalitiessuch as voice, including more complex natural lan-guage, and that in particular in this domain, suchmultimodal interaction can...

Báo cáo khoa học: Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation potx

... USA) and flowjo software (TreeStar, Ashland, OR, USA).Mice and teratoma formationC57BL ⁄ 6J mice and MCH:ICR mice were purchased fromCLEA Japan (Tokyo, Japan). All of the mice were main-tained ... 1283–1297.24 Sakaki-Yumoto M, Kobayashi C, Sato A, Fujimura S,Matsumoto Y, Takasato M, Kodama T, Aburatani H,Asashima M, Yoshida N et al. (2006) The murinehomolog of SALL4, a causative gene in Okihiro ... polypyrimi-dine tract binding protein (PTB) and its neural homo-logue (brPTB) in prenatal and postnatal mouse brain.Mech Dev 101, 217–220.22 Mitsui K, Tokuzawa Y, Itoh H, Segawa K, MurakamiM, Takahashi...

Báo cáo khoa học: Shewasin A, an active pepsin homolog from the bacterium Shewanella amazonensis pptx

... designed as a substrate forCDR1, an atypical AP from Arabidopsis thaliana [13],was readily hydrolyzed by shewasin A at pH 4. Analy-sis by MS revealed that the primary cleavage site wasat Leu*Phe ... to anN-terminal His-tag. (A) HisTrapHP chromatogram. Recombinant shewasin A was puriﬁed by metal ion afﬁnity chromatography with a HisT-rapHP column. Elution was accomplished by using stepwise ... shewasin A amino acid sequence. The Asp of theactive site motif from the N-terminal domain (marked with an aster-isk) was mutated to an Ala to generate the active site mutantshewasin A_ (D3 7A) . Although...

Báo cáo khoa học: Procarboxypeptidase A from the insect pest Helicoverpa armigera and its derived enzyme potx

... to amplify the cDNAcontaining the procarboxypeptidase by PCR. Sense primer5¢-GATTCTCTCGAGAAAAGAAAACATGAAATTTATGATGG-3¢; antisense primer 5¢-CTTCTTTGAGTTATGACGAATTGGATCCTAC-3¢. The original ... was measured against thesubstrate AAFP. The activity of CPAHa in the absenceof inhibitor is defined as vo and the parameter a is defined asvi/vo. By plotting [I]/1 ) a against 1 /a, a line ... (ICREA) and Institut deBiotecnologia i Biomedicina, Universitat Auto`noma de Barcelona, SpainAlthough there is a significant knowledge about mammalianmetallocarboxypeptidases, the data available...

Báo cáo khoa học: "TotalRecall: A Bilingual Concordance for Computer Assisted Translation and Language Learning" potx

... human translators and second language learners. 2 Aligning the corpus Central to TotalRecall is a bilingual corpus and a set of programs that provide the bilingual analyses to yield a translation ... to continuously updating the database with newer information from Sinorama magazine so that the concordance is kept current and relevant to the . To make these up to date and relevant. The ... phrases are subsequently matched up via cross lin-guistic statistical association. Statistical association between the whole phrase as well as words in phrases are used jointly to link a collocation...

Báo cáo khoa học: Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast docx

... similar to those describedpreviously [49,51]. Brieﬂy, to prepare RNA ⁄ DNA hetero-duplexes, a 44 nucleotide long R01 RNA (5¢-GGGCGAAUUCAAAACAAAACAAAACUAGCACCGUAAAGCLeishmania LeIF is an eIF 4A- like ... &Larraga V (2003) Protection in dogs against visceralleishmaniasis caused by Leishmania infantum is achievedby immunization with a heterologous prime-boostregime using DNA and vaccinia recombinant ... world-wide-distributed, parasitic diseases caused by proto-zoan parasites of the genus Leishmania that aretransmitted by female sandﬂies. Leishmania are Tryp-anosomatidae protozoans having two main stages in their...

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ