Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
... M. Amblar and C. M. Arraiano
374 FEBS Journal 272 (2005) 363–374 ª 2004 FEBS
A single mutation in Escherichia coli ribonuclease II
inactivates the enzyme without affecting RNA binding
Mo
´
nica ... (rnb296)
encodes an inactive RNase II enzyme [25]. In this
report we demonstrate that the single amino acid sub-
stitution Asp209fiAsn in RNase II is able...
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... of the
psbA
mRNA is not affected
in the
mf2
strain
The dramatic decrease in D1 synthesis in mf1 and mf2 strains
did not correlate with any significant changes in the
accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCC
ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT
GAA GT-3¢,andtheEcoRI restriction fragment of the
chloroplast genome R14 [16] as a template. T...
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... A point mutation in the ATP synthase of
Rhodobacter capsulatus
results in differential contributions of DpH and Du in driving
the ATP synthesis reaction
Paola Turina and B. Andrea Melandri
Department ... for assessing
theroleofGlu210intheprotonpathwaywithinF
0
.
Alternatively, it can be t hat the mutation has an even
longer-range effect, affecting t he conformation at the...
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline).
Name Size (nt) Sequence
CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG
GTCGCG
ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢
GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
TCTGCTCC
ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢
GCL ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
TCTGCTCC
AT...
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... from a thermally unstable
one: frog, toad and newt DNases I all have a Ser205
insertion in a domain that contains an essential Ca
2+
-
binding site in the mammalian enzymes and are thermally
Fig. ... Amphibian
DNasesIhaveaSer205insertioninaCa
2+
-binding site of
mammalian and avian enzymes that reduces their thermal
stabilities [Takeshita, H., Yasuda, T., Iida, R., Nakajima, T...
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... from the host protein remained
unchanged. The impaired metal -binding ability caused
by Asp to Ala mutations at positions 1 and 3 echoed a
previous observation that these mutations in the intact
STIM1 ... Ca
2+
signal change and the accompa-
nying conformational change in the canonical EF-hand
are probably relayed to the SAM domain via the
paired ‘hidden’ EF-hand, resulti...
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx
... mole-
cular sieve chromatography. Each protein variant
eluted as a single species; however, all protein variants
exhibited larger elution volumes indicating a lower
apparent mass (Table 2). These data ... Interestingly, all protein variants show a drastically reduced quinone
reductase activity in steady-state kinetics. Detailed analysis of the two half
reactions revealed that the...
Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx
... feature specifica-
tions; the latter are themselves items consisting
of a feature name and a feature value in an ar-
rangement. The formal devices already introduced
allow us to state cooccurrence ... restrictions gov-
erning the combination of features and values in
feature specifications; the definition of the
value range of a feature can thus be regarded as
anot...
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... demon-
strate a strong conservation in the binding of C-terminal binding protein-
interacting domains despite great variability in their amino acid sequences.
Finally, this L22 5A point mutation could also ... with the structural data
and the universal conservation of this residue in all C-terminal binding pro-
tein-interacting motifs, mutation of the central leucin...
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... years,
to anoxia and diapause, conditions that are invaria-
bly accompanied by large increases in intracellular
Ca
2+
[3].
Despite intense research on the mammalian PTP
since its characterization by ... for 10 passages. The homog-
enate was centrifuged for 10 min at 300 g and 4 °C, the
upper fatty layer of the supernatant was aspirated, and the
remaining supernatant was centrifuge...
Từ khóa:
- báo cáo khoa học
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Phát hiện xâm nhập dựa trên thuật toán k means
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- BT Tieng anh 6 UNIT 2
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật